MD04G1104200.v1.1

response to cold

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr04
OG0004002
Physical Location & Seq
Forward (+)
19161231 .. 19161792
562 bp
Loading structure...
UTR
Exon/CDS
Intron
MD04G1104200.v1.1.491

Sequence Viewer

Length: 165 bp
ATGGGATCCGAGACATTCCTAGAAGTCTTGTGTGCCATTTTTCTTCCACCAGTTGGTGTCTTCATTCGCTATGGCTGCGGGGTGGAGTTTTGGATTGCCGTATTGCTGACGCTGTTTGGATATATACCAGGAATTATATATGCAGTTTATGTCTTGGTTGTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0005623 GO:0005886 GO:0016020 GO:0044464 GO:0071944
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Pmp3

Protein Analysis

55

Amino Acids

5.97

Weight (kDa)

4.25

Isoelectric Point (pI)

21.14

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Pmp3 PF01679 6 - 52 5.1e-22 Proteolipid membrane potential modulator
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 53
AciI CCGC 1 cut(s) 78
AclWI GGATC 1 cut(s) 13
AfiI CCNNNNNNNGG 1 cut(s) 53
AjnI CCWGG 1 cut(s) 127
Alw26I GTCTC 1 cut(s) 5
AlwI GGATC 1 cut(s) 13
ApeKI GCWGC 1 cut(s) 75
BamHI GGATCC 1 cut(s) 5
BbsI GAAGAC 1 cut(s) 52
BbvI GCAGC 1 cut(s) 62
BceAI ACGGC 1 cut(s) 83
BciT130I CCWGG 1 cut(s) 129
BcoDI GTCTC 1 cut(s) 5
BfaI CTAG 1 cut(s) 20
BisI GCNGC 1 cut(s) 76
BlsI GCNGC 1 cut(s) 77
Bme1390I CCNGG 1 cut(s) 129
BmiI GGNNCC 1 cut(s) 7
BmrFI CCNGG 1 cut(s) 129
BpiI GAAGAC 1 cut(s) 52
Bsc4I CCNNNNNNNGG 1 cut(s) 53
Bse1I ACTGG 1 cut(s) 50
BseBI CCWGG 1 cut(s) 129
BseLI CCNNNNNNNGG 1 cut(s) 53
BseNI ACTGG 1 cut(s) 50
BseXI GCAGC 1 cut(s) 62
BslI CCNNNNNNNGG 1 cut(s) 53
BsmAI GTCTC 1 cut(s) 5
Bsp143I GATC 1 cut(s) 5
BspACI CCGC 1 cut(s) 78
BspLI GGNNCC 1 cut(s) 7
BspPI GGATC 1 cut(s) 13
BsrI ACTGG 1 cut(s) 50
BssMI GATC 1 cut(s) 5
Bst2UI CCWGG 1 cut(s) 129
BstKTI GATC 1 cut(s) 8
BstMAI GTCTC 1 cut(s) 5
BstMBI GATC 1 cut(s) 5
BstMWI GCNNNNNNNGC 1 cut(s) 75
BstNI CCWGG 1 cut(s) 129
BstSCI CCNGG 1 cut(s) 127
BstV1I GCAGC 1 cut(s) 62
BstV2I GAAGAC 1 cut(s) 52
BstX2I RGATCY 1 cut(s) 5
BstYI RGATCY 1 cut(s) 5
CseI GACGC 1 cut(s) 118
CviJI RGCY 1 cut(s) 75
CviKI_1 RGCY 1 cut(s) 75
DpnI GATC 1 cut(s) 7
DpnII GATC 1 cut(s) 5
EcoRII CCWGG 1 cut(s) 127
FaiI YATR 8 cut(s) 72, 123, 125, 137, 139, 141, 150, 163
FauI CCCGC 1 cut(s) 71
Fnu4HI GCNGC 1 cut(s) 76
Fsp4HI GCNGC 1 cut(s) 76
FspBI CTAG 1 cut(s) 20
GluI GCNGC 1 cut(s) 76
HgaI GACGC 1 cut(s) 118
Hpy188I TCNGA 1 cut(s) 10
HpyCH4V TGCA 1 cut(s) 143
HpyF10VI GCNNNNNNNGC 1 cut(s) 75
Kzo9I GATC 1 cut(s) 5
LpnPI CCDG 3 cut(s) 63, 114, 141
Lsp1109I GCAGC 1 cut(s) 62
MaeI CTAG 1 cut(s) 20
MalI GATC 1 cut(s) 7
MboI GATC 1 cut(s) 5
MboII GAAGA 2 cut(s) 35, 52
MflI RGATCY 1 cut(s) 5
MluCI AATT 1 cut(s) 132
MspR9I CCNGG 1 cut(s) 129
MvaI CCWGG 1 cut(s) 129
MwoI GCNNNNNNNGC 1 cut(s) 75
NdeII GATC 1 cut(s) 5
NlaIV GGNNCC 1 cut(s) 7
PflMI CCANNNNNTGG 1 cut(s) 53
PkrI GCNGC 1 cut(s) 77
Psp6I CCWGG 1 cut(s) 127
PspGI CCWGG 1 cut(s) 127
PspN4I GGNNCC 1 cut(s) 7
PsuI RGATCY 1 cut(s) 5
SatI GCNGC 1 cut(s) 76
Sau3AI GATC 1 cut(s) 5
ScrFI CCNGG 1 cut(s) 129
SgeI CNNG 7 cut(s) 22, 32, 40, 62, 91, 140, 141
Sse9I AATT 1 cut(s) 132
SsiI CCGC 1 cut(s) 78
SspMI CTAG 1 cut(s) 20
StyD4I CCNGG 1 cut(s) 127
TasI AATT 1 cut(s) 132
TseI GCWGC 1 cut(s) 75
TspDTI ATGAA 1 cut(s) 52
Van91I CCANNNNNTGG 1 cut(s) 53
XspI CTAG 1 cut(s) 20
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.