MD12G1199300.v1.1

Hydrophobic protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr12
OG0004002
Physical Location & Seq
Forward (+)
28037569 .. 28039969
2401 bp
Loading structure...
UTR
Exon/CDS
Intron
MD12G1199300.v1.1.491

Sequence Viewer

Length: 177 bp
ATGGCGAGCGAAGGAACATTAAACTGCGTTGACATTCTCATCGCCATCCTCTTGCCTCCTCTTGGAGTCTTCCTCAAGTTTGGTTGCCATGCGGAATTCTGGATCTGTTTGTTGCTGACCATCTTTGGTTACCTCCCTGGGATTATTTATGCCATTTATGTCATCACCAAGTATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Pmp3

Protein Analysis

59

Amino Acids

6.47

Weight (kDa)

5.43

Isoelectric Point (pI)

34.66

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Pmp3 PF01679 9 - 55 1.5e-21 Proteolipid membrane potential modulator
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 92
AclWI GGATC 1 cut(s) 110
AcsI RAATTY 1 cut(s) 95
AfiI CCNNNNNNNGG 1 cut(s) 62
AjnI CCWGG 1 cut(s) 136
AlwI GGATC 1 cut(s) 110
ApoI RAATTY 1 cut(s) 95
AsuHPI GGTGA 1 cut(s) 157
BbsI GAAGAC 1 cut(s) 61
BccI CCATC 2 cut(s) 53, 128
BciT130I CCWGG 1 cut(s) 138
Bme1390I CCNGG 1 cut(s) 138
BmrFI CCNGG 1 cut(s) 138
BpiI GAAGAC 1 cut(s) 61
BplI GAGNNNNNCTC 2 cut(s) 57, 89
BpuEI CTTGAG 1 cut(s) 59
BsaJI CCNNGG 2 cut(s) 136, 137
Bsc4I CCNNNNNNNGG 1 cut(s) 62
BseBI CCWGG 1 cut(s) 138
BseDI CCNNGG 2 cut(s) 136, 137
BseGI GGATG 1 cut(s) 45
BseLI CCNNNNNNNGG 1 cut(s) 62
BseRI GAGGAG 1 cut(s) 48
BslI CCNNNNNNNGG 1 cut(s) 62
Bsp143I GATC 1 cut(s) 102
BspACI CCGC 1 cut(s) 92
BspPI GGATC 1 cut(s) 110
BssECI CCNNGG 2 cut(s) 136, 137
BssMI GATC 1 cut(s) 102
Bst2UI CCWGG 1 cut(s) 138
BstC8I GCNNGC 1 cut(s) 7
BstEII GGTNACC 1 cut(s) 128
BstF5I GGATG 1 cut(s) 45
BstKTI GATC 1 cut(s) 105
BstMBI GATC 1 cut(s) 102
BstNI CCWGG 1 cut(s) 138
BstPI GGTNACC 1 cut(s) 128
BstSCI CCNGG 1 cut(s) 136
BstV2I GAAGAC 1 cut(s) 61
BstX2I RGATCY 1 cut(s) 102
BstYI RGATCY 1 cut(s) 102
BtgZI GCGATG 1 cut(s) 25
BtsCI GGATG 1 cut(s) 45
Cac8I GCNNGC 1 cut(s) 7
CviAII CATG 1 cut(s) 89
DpnI GATC 1 cut(s) 104
DpnII GATC 1 cut(s) 102
Eco91I GGTNACC 1 cut(s) 128
EcoO65I GGTNACC 1 cut(s) 128
EcoRI GAATTC 1 cut(s) 95
EcoRII CCWGG 1 cut(s) 136
FaeI CATG 1 cut(s) 92
FaiI YATR 3 cut(s) 90, 150, 159
FatI CATG 1 cut(s) 88
FokI GGATG 1 cut(s) 32
Hin1II CATG 1 cut(s) 92
HincII GTYRAC 1 cut(s) 31
HindII GTYRAC 1 cut(s) 31
HinfI GANTC 1 cut(s) 66
HphI GGTGA 1 cut(s) 157
Hpy166II GTNNAC 1 cut(s) 31
Hpy188III TCNNGA 1 cut(s) 100
Hpy8I GTNNAC 1 cut(s) 31
HpyAV CCTTC 1 cut(s) 5
Hsp92II CATG 1 cut(s) 92
Kzo9I GATC 1 cut(s) 102
LpnPI CCDG 3 cut(s) 85, 123, 150
MaeIII GTNAC 1 cut(s) 128
MalI GATC 1 cut(s) 104
MboI GATC 1 cut(s) 102
MboII GAAGA 1 cut(s) 61
MflI RGATCY 1 cut(s) 102
MluCI AATT 1 cut(s) 95
MlyI GAGTC 1 cut(s) 75
MnlI CCTC 5 cut(s) 59, 66, 69, 83, 143
MseI TTAA 1 cut(s) 20
MspR9I CCNGG 1 cut(s) 138
MvaI CCWGG 1 cut(s) 138
NdeII GATC 1 cut(s) 102
NlaIII CATG 1 cut(s) 92
PasI CCCWGGG 1 cut(s) 137
PleI GAGTC 1 cut(s) 74
PpsI GAGTC 1 cut(s) 74
Psp6I CCWGG 1 cut(s) 136
PspEI GGTNACC 1 cut(s) 128
PspGI CCWGG 1 cut(s) 136
PsuI RGATCY 1 cut(s) 102
SaqAI TTAA 1 cut(s) 20
Sau3AI GATC 1 cut(s) 102
SchI GAGTC 1 cut(s) 75
ScrFI CCNGG 1 cut(s) 138
SetI ASST 1 cut(s) 135
SgeI CNNG 8 cut(s) 18, 64, 74, 88, 101, 112, 149, 150
SmlI CTYRAG 1 cut(s) 74
SmoI CTYRAG 1 cut(s) 74
Sse9I AATT 1 cut(s) 95
SsiI CCGC 1 cut(s) 92
StyD4I CCNGG 1 cut(s) 136
TasI AATT 1 cut(s) 95
Tru1I TTAA 1 cut(s) 20
Tru9I TTAA 1 cut(s) 20
XapI RAATTY 1 cut(s) 95
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.