RchiOBHm_Chr3g0458641

Hydrophobic protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Reverse (-)
7263964 .. 7265352
1389 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ42528

Sequence Viewer

Length: 174 bp
ATGCCGAGTGAAGGAACAGCAAACTTCATCGATATCCTCATCGCCATCCTCTTGCCTCCTCTTGGGGTCTTCCTCAAGTTTGGCTGCAAAGTGGAGTTCTGGATCTGTGTGTTGCTGACCATTTTCGGTTACATCCCTGGGATTATCTATGCCATCTATATAATCACCAAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

57

Amino Acids

6.36

Weight (kDa)

5.93

Isoelectric Point (pI)

30.05

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Pmp3 PF01679 9 - 55 5e-22 Proteolipid membrane potential modulator
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 110
AdeI CACNNNGTG 1 cut(s) 171
AfiI CCNNNNNNNGG 2 cut(s) 11, 62
AjnI CCWGG 1 cut(s) 136
AlwI GGATC 1 cut(s) 110
ApeKI GCWGC 1 cut(s) 84
AsuHPI GGTGA 1 cut(s) 157
BbsI GAAGAC 1 cut(s) 61
BbvI GCAGC 1 cut(s) 71
BccI CCATC 2 cut(s) 53, 161
BciT130I CCWGG 1 cut(s) 138
BisI GCNGC 1 cut(s) 85
BlsI GCNGC 1 cut(s) 86
Bme1390I CCNGG 1 cut(s) 138
BmrFI CCNGG 1 cut(s) 138
BpiI GAAGAC 1 cut(s) 61
BpuEI CTTGAG 1 cut(s) 59
Bsa29I ATCGAT 1 cut(s) 30
BsaJI CCNNGG 2 cut(s) 136, 137
Bsc4I CCNNNNNNNGG 2 cut(s) 11, 62
BseBI CCWGG 1 cut(s) 138
BseCI ATCGAT 1 cut(s) 30
BseDI CCNNGG 2 cut(s) 136, 137
BseGI GGATG 2 cut(s) 45, 132
BseLI CCNNNNNNNGG 2 cut(s) 11, 62
BseRI GAGGAG 1 cut(s) 48
BseXI GCAGC 1 cut(s) 71
BshVI ATCGAT 1 cut(s) 30
BslI CCNNNNNNNGG 2 cut(s) 11, 62
Bsp143I GATC 1 cut(s) 102
BspDI ATCGAT 1 cut(s) 30
BspPI GGATC 1 cut(s) 110
BssECI CCNNGG 2 cut(s) 136, 137
BssMI GATC 1 cut(s) 102
Bst2UI CCWGG 1 cut(s) 138
BstF5I GGATG 2 cut(s) 45, 132
BstKTI GATC 1 cut(s) 105
BstMBI GATC 1 cut(s) 102
BstNI CCWGG 1 cut(s) 138
BstSCI CCNGG 1 cut(s) 136
BstV1I GCAGC 1 cut(s) 71
BstV2I GAAGAC 1 cut(s) 61
BstX2I RGATCY 1 cut(s) 102
BstYI RGATCY 1 cut(s) 102
Bsu15I ATCGAT 1 cut(s) 30
BsuTUI ATCGAT 1 cut(s) 30
BtgZI GCGATG 1 cut(s) 25
BtsCI GGATG 2 cut(s) 45, 132
ClaI ATCGAT 1 cut(s) 30
CviJI RGCY 1 cut(s) 84
CviKI_1 RGCY 1 cut(s) 84
DpnI GATC 1 cut(s) 104
DpnII GATC 1 cut(s) 102
DraIII CACNNNGTG 1 cut(s) 171
Eco32I GATATC 1 cut(s) 34
EcoRII CCWGG 1 cut(s) 136
EcoRV GATATC 1 cut(s) 34
FaiI YATR 3 cut(s) 150, 159, 161
Fnu4HI GCNGC 1 cut(s) 85
FokI GGATG 2 cut(s) 32, 119
Fsp4HI GCNGC 1 cut(s) 85
GluI GCNGC 1 cut(s) 85
HphI GGTGA 1 cut(s) 157
Hpy188III TCNNGA 1 cut(s) 100
HpyAV CCTTC 1 cut(s) 5
HpyCH4V TGCA 1 cut(s) 87
Kzo9I GATC 1 cut(s) 102
LpnPI CCDG 3 cut(s) 85, 123, 150
Lsp1109I GCAGC 1 cut(s) 71
MaeIII GTNAC 1 cut(s) 128
MalI GATC 1 cut(s) 104
MboI GATC 1 cut(s) 102
MboII GAAGA 1 cut(s) 61
MflI RGATCY 1 cut(s) 102
MnlI CCTC 5 cut(s) 47, 59, 66, 69, 83
MspR9I CCNGG 1 cut(s) 138
MvaI CCWGG 1 cut(s) 138
NdeII GATC 1 cut(s) 102
NmeAIII GCCGAG 1 cut(s) 30
PasI CCCWGGG 1 cut(s) 137
PkrI GCNGC 1 cut(s) 86
Psp6I CCWGG 1 cut(s) 136
PspGI CCWGG 1 cut(s) 136
PsuI RGATCY 1 cut(s) 102
SatI GCNGC 1 cut(s) 85
Sau3AI GATC 1 cut(s) 102
ScrFI CCNGG 1 cut(s) 138
SgeI CNNG 7 cut(s) 18, 64, 74, 88, 112, 149, 150
SmlI CTYRAG 1 cut(s) 74
SmoI CTYRAG 1 cut(s) 74
StyD4I CCNGG 1 cut(s) 136
TaqI TCGA 1 cut(s) 30
TseI GCWGC 1 cut(s) 84
TspDTI ATGAA 1 cut(s) 16
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.