AT3G33393

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
3
OG0004040
Physical Location & Seq
Reverse (-)
14037798 .. 14038234
437 bp
Loading structure...
UTR
Exon/CDS
Intron
AT3G33393.1

Sequence Viewer

Length: 354 bp
ATGGAGAAAGAGGGCAACGTCTTTCGGTGCTTCAAAACCTGGAAAGACACGATCCTGCCCACCTTCGACAAATGGCGACCTACAATTCGCGAGCGATTTTTACTCCATGCTCATCATTCATCTCGGGCGAACAACGAGCTTAACGACATGATCGAGCACTATGAAGGATTACTGCTCAGTATAGAACAGGATATTGATGCTTGGAAAGGCAAGTTTTCTTCCCTCGAGGCCGATCTCCGCTCCTCCTCTGACTTTAAACAGAAACTAGAGGATCGAGTCGACCATCTATCTTCTAAGCTCATGAGATCGAATGGCGAGTTGCATGATCAGTACCAAAGATACGACAAGCTCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

117

Amino Acids

14.01

Weight (kDa)

6.29

Isoelectric Point (pI)

36.13

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AbsI CCTCGAGG 1 cut(s) 224
AccBSI CCGCTC 1 cut(s) 240
AccI GTMKAC 1 cut(s) 279
AccII CGCG 1 cut(s) 90
AciI CCGC 1 cut(s) 238
AclWI GGATC 2 cut(s) 46, 279
AfaI GTAC 1 cut(s) 332
AgsI TTSAA 1 cut(s) 34
AjnI CCWGG 1 cut(s) 38
AluBI AGCT 3 cut(s) 139, 298, 349
AluI AGCT 3 cut(s) 139, 298, 349
Alw21I GWGCWC 1 cut(s) 159
AlwI GGATC 2 cut(s) 46, 279
Ama87I CYCGRG 2 cut(s) 123, 224
AoxI GGCC 1 cut(s) 228
ArsI GACNNNNNNTTYG 2 cut(s) 69, 101
AvaI CYCGRG 2 cut(s) 123, 224
Bbv12I GWGCWC 1 cut(s) 159
BccI CCATC 1 cut(s) 291
BciT130I CCWGG 1 cut(s) 40
BclI TGATCA 1 cut(s) 325
BfaI CTAG 2 cut(s) 266, 352
Bme1390I CCNGG 1 cut(s) 40
BmeT110I CYCGRG 2 cut(s) 123, 224
BmrFI CCNGG 1 cut(s) 40
BmsI GCATC 1 cut(s) 187
BseBI CCWGG 1 cut(s) 40
BseMII CTCAG 1 cut(s) 190
BseRI GAGGAG 2 cut(s) 232, 235
Bsh1236I CGCG 1 cut(s) 90
BshFI GGCC 1 cut(s) 230
BsiHKAI GWGCWC 1 cut(s) 159
BsiHKCI CYCGRG 2 cut(s) 123, 224
BsnI GGCC 1 cut(s) 230
BsoBI CYCGRG 2 cut(s) 123, 224
Bsp1286I GDGCHC 1 cut(s) 159
Bsp143I GATC 6 cut(s) 51, 150, 232, 271, 305, 325
Bsp68I TCGCGA 1 cut(s) 90
BspACI CCGC 1 cut(s) 238
BspANI GGCC 1 cut(s) 230
BspCNI CTCAG 1 cut(s) 189
BspFNI CGCG 1 cut(s) 90
BspHI TCATGA 1 cut(s) 300
BspPI GGATC 2 cut(s) 46, 279
BsrBI CCGCTC 1 cut(s) 240
BssMI GATC 6 cut(s) 51, 150, 232, 271, 305, 325
Bst2UI CCWGG 1 cut(s) 40
BstC8I GCNNGC 1 cut(s) 92
BstDEI CTNAG 2 cut(s) 176, 294
BstFNI CGCG 1 cut(s) 90
BstKTI GATC 6 cut(s) 54, 153, 235, 274, 308, 328
BstMBI GATC 6 cut(s) 51, 150, 232, 271, 305, 325
BstNI CCWGG 1 cut(s) 40
BstSCI CCNGG 1 cut(s) 38
BstUI CGCG 1 cut(s) 90
BsuRI GGCC 1 cut(s) 230
BtuMI TCGCGA 1 cut(s) 90
Cac8I GCNNGC 1 cut(s) 92
CciI TCATGA 1 cut(s) 300
Csp6I GTAC 1 cut(s) 331
CviAII CATG 4 cut(s) 107, 148, 301, 323
CviJI RGCY 4 cut(s) 139, 230, 298, 349
CviKI_1 RGCY 4 cut(s) 139, 230, 298, 349
CviQI GTAC 1 cut(s) 331
DdeI CTNAG 2 cut(s) 176, 294
DpnI GATC 6 cut(s) 53, 152, 234, 273, 307, 327
DpnII GATC 6 cut(s) 51, 150, 232, 271, 305, 325
DraI TTTAAA 1 cut(s) 256
Eco88I CYCGRG 2 cut(s) 123, 224
EcoRII CCWGG 1 cut(s) 38
FaeI CATG 4 cut(s) 110, 151, 304, 326
FaiI YATR 6 cut(s) 108, 149, 162, 182, 302, 324
FatI CATG 4 cut(s) 106, 147, 300, 322
FbaI TGATCA 1 cut(s) 325
FblI GTMKAC 1 cut(s) 279
FspBI CTAG 2 cut(s) 266, 352
HaeIII GGCC 1 cut(s) 230
Hin1II CATG 4 cut(s) 110, 151, 304, 326
HincII GTYRAC 1 cut(s) 280
HindII GTYRAC 1 cut(s) 280
HinfI GANTC 1 cut(s) 276
Hpy166II GTNNAC 1 cut(s) 280
Hpy188I TCNGA 1 cut(s) 250
Hpy188III TCNNGA 2 cut(s) 89, 301
Hpy8I GTNNAC 1 cut(s) 280
HpyAV CCTTC 2 cut(s) 73, 158
HpyCH4IV ACGT 1 cut(s) 18
HpyCH4V TGCA 1 cut(s) 322
HpyF3I CTNAG 2 cut(s) 176, 294
HpySE526I ACGT 1 cut(s) 18
Hsp92II CATG 4 cut(s) 110, 151, 304, 326
Ksp22I TGATCA 1 cut(s) 325
Kzo9I GATC 6 cut(s) 51, 150, 232, 271, 305, 325
LmnI GCTCC 1 cut(s) 245
LpnPI CCDG 4 cut(s) 25, 52, 68, 173
LweI GCATC 1 cut(s) 187
MaeI CTAG 2 cut(s) 266, 352
MaeII ACGT 1 cut(s) 18
MalI GATC 6 cut(s) 53, 152, 234, 273, 307, 327
MbiI CCGCTC 1 cut(s) 240
MboI GATC 6 cut(s) 51, 150, 232, 271, 305, 325
MboII GAAGA 2 cut(s) 210, 282
MhlI GDGCHC 1 cut(s) 159
MluCI AATT 1 cut(s) 84
MlyI GAGTC 1 cut(s) 285
MnlI CCTC 6 cut(s) 4, 220, 233, 253, 256, 262
MseI TTAA 2 cut(s) 141, 255
MspR9I CCNGG 1 cut(s) 40
MvaI CCWGG 1 cut(s) 40
MvnI CGCG 1 cut(s) 90
NdeII GATC 6 cut(s) 51, 150, 232, 271, 305, 325
NlaIII CATG 4 cut(s) 110, 151, 304, 326
NruI TCGCGA 1 cut(s) 90
PaeR7I CTCGAG 1 cut(s) 224
PagI TCATGA 1 cut(s) 300
PcsI WCGNNNNNNNCGW 2 cut(s) 141, 150
PleI GAGTC 1 cut(s) 284
PpsI GAGTC 1 cut(s) 284
Psp6I CCWGG 1 cut(s) 38
PspGI CCWGG 1 cut(s) 38
PspXI VCTCGAGB 1 cut(s) 224
RruI TCGCGA 1 cut(s) 90
RsaI GTAC 1 cut(s) 332
RsaNI GTAC 1 cut(s) 331
SalI GTCGAC 1 cut(s) 278
SaqAI TTAA 2 cut(s) 141, 255
Sau3AI GATC 6 cut(s) 51, 150, 232, 271, 305, 325
SchI GAGTC 1 cut(s) 285
ScrFI CCNGG 1 cut(s) 40
SduI GDGCHC 1 cut(s) 159
SetI ASST 7 cut(s) 21, 41, 65, 82, 141, 300, 351
SfaNI GCATC 1 cut(s) 187
Sfr274I CTCGAG 1 cut(s) 224
SlaI CTCGAG 1 cut(s) 224
SmlI CTYRAG 1 cut(s) 224
SmoI CTYRAG 1 cut(s) 224
Sse9I AATT 1 cut(s) 84
SsiI CCGC 1 cut(s) 238
SspMI CTAG 2 cut(s) 266, 352
StyD4I CCNGG 1 cut(s) 38
TaiI ACGT 1 cut(s) 21
TaqI TCGA 6 cut(s) 66, 153, 225, 274, 279, 308
TasI AATT 1 cut(s) 84
Tru1I TTAA 2 cut(s) 141, 255
Tru9I TTAA 2 cut(s) 141, 255
TspDTI ATGAA 2 cut(s) 108, 177
XhoI CTCGAG 1 cut(s) 224
XmiI GTMKAC 1 cut(s) 279
XspI CTAG 2 cut(s) 266, 352
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.