AT5G56550

RNA binding

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
5
Physical Location & Seq
Reverse (-)
22895616 .. 22896734
1119 bp
Loading structure...
UTR
Exon/CDS
Intron
AT5G56550.1

Sequence Viewer

Length: 519 bp
ATGTTCAAAGAGATGAATCTGAATCTGAAGCAAATGGGCAACATGATCTATGAAGATCCAACAAGGATCCAAGAAGAAGAAGACATTGTTCAAGAAGTTTCAACAACATTCTCTGATGAAGAAGATAACTCATCATCTTGTTCATTATCTTCTTCCATGTGTTCTGATTTTACAGAGGATGATGATGATGATGATGTTTCTTCATCTTCTTCAAATGGACCTCTTGAAGATCTCTCTGACCTCATGTCACACCTCCCTATCAAGAGGGGATTATCAAAGTTCTATGAAGGAAAATCTCAATCATTCACATCACTAGGAAATGTTAAAAGCCTTGAAGATCTTATGAAGAGAGGGTTTAAAAGTAGAAACTATGGAGCAAAAAGAAAGTCATCTAGGAGTACTGGAGGGATTTTAGATCAAAGCTACAAAAGGGTTTTTAGTCCTAAAGCTACAATCTCCAAGAAACCCAACAGAACACCTTCCTCTGTTCTCTCTTGTCTAGCCAGAAGAAGACATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

172

Amino Acids

19.31

Weight (kDa)

5.77

Isoelectric Point (pI)

71.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 3 cut(s) 50, 61, 74
AcuI CTGAAG 1 cut(s) 47
AfaI GTAC 1 cut(s) 400
AgsI TTSAA 6 cut(s) 7, 92, 102, 213, 227, 335
AhdI GACNNNNNGTC 1 cut(s) 244
AluBI AGCT 2 cut(s) 423, 449
AluI AGCT 2 cut(s) 423, 449
AlwI GGATC 3 cut(s) 50, 61, 74
ArsI GACNNNNNNTTYG 2 cut(s) 371, 403
Asp700I GAANNNNTTC 1 cut(s) 478
AspS9I GGNCC 1 cut(s) 218
AvaII GGWCC 1 cut(s) 218
BamHI GGATCC 1 cut(s) 66
BbsI GAAGAC 1 cut(s) 87
BfaI CTAG 3 cut(s) 314, 393, 500
BglII AGATCT 2 cut(s) 229, 337
BmcAI AGTACT 1 cut(s) 400
Bme18I GGWCC 1 cut(s) 218
BmeRI GACNNNNNGTC 1 cut(s) 244
BmgT120I GGNCC 1 cut(s) 218
BmiI GGNNCC 1 cut(s) 68
BpiI GAAGAC 1 cut(s) 87
BpmI CTGGAG 1 cut(s) 423
Bse1I ACTGG 1 cut(s) 406
BseGI GGATG 1 cut(s) 184
BseNI ACTGG 1 cut(s) 406
Bsp143I GATC 6 cut(s) 45, 55, 66, 229, 337, 415
BspLI GGNNCC 1 cut(s) 68
BspPI GGATC 3 cut(s) 50, 61, 74
BsrI ACTGG 1 cut(s) 406
BssMI GATC 6 cut(s) 45, 55, 66, 229, 337, 415
Bst6I CTCTTC 1 cut(s) 341
BstF5I GGATG 1 cut(s) 184
BstKTI GATC 6 cut(s) 48, 58, 69, 232, 340, 418
BstMBI GATC 6 cut(s) 45, 55, 66, 229, 337, 415
BstV2I GAAGAC 1 cut(s) 87
BstX2I RGATCY 4 cut(s) 55, 66, 229, 337
BstYI RGATCY 4 cut(s) 55, 66, 229, 337
BtsCI GGATG 1 cut(s) 184
Cfr13I GGNCC 1 cut(s) 218
Csp6I GTAC 1 cut(s) 399
CviAII CATG 3 cut(s) 43, 157, 244
CviJI RGCY 4 cut(s) 330, 423, 449, 503
CviKI_1 RGCY 4 cut(s) 330, 423, 449, 503
CviQI GTAC 1 cut(s) 399
DpnI GATC 6 cut(s) 47, 57, 68, 231, 339, 417
DpnII GATC 6 cut(s) 45, 55, 66, 229, 337, 415
DraI TTTAAA 1 cut(s) 358
DriI GACNNNNNGTC 1 cut(s) 244
Eam1104I CTCTTC 1 cut(s) 341
Eam1105I GACNNNNNGTC 1 cut(s) 244
EarI CTCTTC 1 cut(s) 341
Eco47I GGWCC 1 cut(s) 218
Eco57I CTGAAG 1 cut(s) 47
FaeI CATG 3 cut(s) 46, 160, 247
FaiI YATR 7 cut(s) 44, 51, 158, 245, 285, 344, 372
FatI CATG 3 cut(s) 42, 156, 243
FokI GGATG 1 cut(s) 191
FspBI CTAG 3 cut(s) 314, 393, 500
GsuI CTGGAG 1 cut(s) 423
Hin1II CATG 3 cut(s) 46, 160, 247
HinfI GANTC 2 cut(s) 16, 22
Hpy188I TCNGA 5 cut(s) 21, 27, 115, 166, 238
Hpy188III TCNNGA 3 cut(s) 92, 224, 262
HpyAV CCTTC 2 cut(s) 281, 489
Hsp92II CATG 3 cut(s) 46, 160, 247
Kzo9I GATC 6 cut(s) 45, 55, 66, 229, 337, 415
LmnI GCTCC 1 cut(s) 374
LpnPI CCDG 1 cut(s) 387
MaeI CTAG 3 cut(s) 314, 393, 500
MaeIII GTNAC 1 cut(s) 246
MalI GATC 6 cut(s) 47, 57, 68, 231, 339, 417
MboI GATC 6 cut(s) 45, 55, 66, 229, 337, 415
MflI RGATCY 4 cut(s) 55, 66, 229, 337
MmeI TCCRAC 1 cut(s) 83
MnlI CCTC 8 cut(s) 169, 231, 251, 258, 263, 344, 398, 493
MroXI GAANNNNTTC 1 cut(s) 478
MseI TTAA 2 cut(s) 324, 357
NdeII GATC 6 cut(s) 45, 55, 66, 229, 337, 415
NlaIII CATG 3 cut(s) 46, 160, 247
NlaIV GGNNCC 1 cut(s) 68
NmuCI GTSAC 1 cut(s) 246
PdmI GAANNNNTTC 1 cut(s) 478
PfeI GAWTC 2 cut(s) 16, 22
PspN4I GGNNCC 1 cut(s) 68
PspPI GGNCC 1 cut(s) 218
PsuI RGATCY 4 cut(s) 55, 66, 229, 337
RsaI GTAC 1 cut(s) 400
RsaNI GTAC 1 cut(s) 399
SaqAI TTAA 2 cut(s) 324, 357
Sau3AI GATC 6 cut(s) 45, 55, 66, 229, 337, 415
Sau96I GGNCC 1 cut(s) 218
ScaI AGTACT 1 cut(s) 400
SetI ASST 6 cut(s) 223, 243, 255, 425, 451, 481
SinI GGWCC 1 cut(s) 218
SspMI CTAG 3 cut(s) 314, 393, 500
TatI WGTACW 1 cut(s) 398
TfiI GAWTC 2 cut(s) 16, 22
Tru1I TTAA 2 cut(s) 324, 357
Tru9I TTAA 2 cut(s) 324, 357
TseFI GTSAC 1 cut(s) 246
Tsp45I GTSAC 1 cut(s) 246
TspDTI ATGAA 7 cut(s) 29, 66, 132, 132, 192, 300, 359
VpaK11BI GGWCC 1 cut(s) 218
XmnI GAANNNNTTC 1 cut(s) 478
XspI CTAG 3 cut(s) 314, 393, 500
ZrmI AGTACT 1 cut(s) 400
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.