Basic Information

Type: gene

Biological Identity

Species

prunus_persica

Chromosome

Pp07

Orthogroup ID

OG0003411

Physical Location & Seq

Genomic Coordinates Forward (+)

19633250 .. 19634978

Gene Structure 1729 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Prupe.7G218000.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 552 bp

ATGGGTCATCATGAAGAAGAAAAGAGGATTTTTGAGGATCAAAATATAGAAGAAAAGCATGCTTATCAAGTTGGGCAGGATTATTGGGTTATCAAGGAAGATCATCATCATCATCATGAAGAAAGCTCAAGATCTATTGAATCCTCACTGGAGAATTCAATGAACTCCATTGAATCATCATCTTCATCAGACTTGGTAGAGGATGCATCATCTGCTTCCACATCATGCTCCTCATCACCTTCCAATGGGCCTCTTTATGAACTATCTGACCTAATGATCCATCTTCCCATGAGGAGAGGTTTGTCAAAATATTATCAAGGCAAGGCCCAATCTTTCACATCCCTAGCAAGTGTGAAGAGCATAGAAGACCTGGCAAAGAAGGTGGCTCCTTACAGAAGGAAAATAAAGCCATGCAAGAGCTATGGTGGGGGTTTGGATGGTGGTCACAAATCATATACTACTACTCCTAAAGCCATTATCTCAAAGAAAGCTTCTTCAAGAGGAGGATCTTTCTTATATTCCATAAGTAAGAGAGGAAAATTGTTGGGTTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

184

Amino Acids

20.3

Weight (kDa)

8.42

Isoelectric Point (pI)

65.99

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003411)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G56550
fragaria_vesca	FvH4_1g06410 FvH4_6g32530
malus_domestica	MD02G1067400.v1.1 MD09G1201500.v1.1 MD10G1246900.v1.1 MD15G1198100.v1.1 MD15G1199200.v1.1 MD17G1181600.v1.1
prunus_persica	Prupe.3G057300_v2.0.a1 Prupe.3G057300_v2.0.a1 Prupe.7G218000_v2.0.a1
pyrus_communis	pycom02g05340 pycom09g11820 pycom12654g00170 pycom15g17670 pycom17g19120
rosa_chinensis	RchiOBHm_Chr2g0092151 RchiOBHm_Chr2g0140911
rosa_laevigata	RLG00000016279 RLG00000019901
rosa_multiflora	Rmu_sc0003848.1_g000009 Rmu_sc0013552.1_g000005
rosa_roxburghii	Rroxscaffold_2G00104390 Rroxscaffold_2G00149430
rosa_rugosa	Rorug02G0023200 Rorug02G0365600
rosa_samantha	Rh2AG068900 Rh2AG417000 Rh2BG068200 Rh2BG426900 Rh2CG069400 Rh2CG403300 Rh2DG436500
rosa_wichuraiana	Rw2G006340 Rw2G034120

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	3 cut(s)	45, 271, 514
AcsI	RAATTY	1 cut(s)	154
AfiI	CCNNNNNNNGG	1 cut(s)	245
AgsI	TTSAA	4 cut(s)	140, 159, 173, 498
AjnI	CCWGG	1 cut(s)	369
AluBI	AGCT	3 cut(s)	126, 420, 491
AluI	AGCT	3 cut(s)	126, 420, 491
AlwI	GGATC	3 cut(s)	45, 271, 514
AoxI	GGCC	2 cut(s)	248, 324
ApoI	RAATTY	1 cut(s)	154
AspS9I	GGNCC	2 cut(s)	248, 325
AsuHPI	GGTGA	1 cut(s)	228
BbsI	GAAGAC	1 cut(s)	372
BccI	CCATC	2 cut(s)	288, 431
BciT130I	CCWGG	1 cut(s)	371
BfaI	CTAG	1 cut(s)	344
BglII	AGATCT	1 cut(s)	131
Bme1390I	CCNGG	1 cut(s)	371
BmgT120I	GGNCC	2 cut(s)	248, 325
BmiI	GGNNCC	1 cut(s)	387
BmrFI	CCNGG	1 cut(s)	371
BmsI	GCATC	2 cut(s)	193, 215
BpiI	GAAGAC	1 cut(s)	372
BpmI	CTGGAG	1 cut(s)	170
BpuEI	CTTGAG	1 cut(s)	112
BsaBI	GATNNNNATC	1 cut(s)	105
BsaXI	ACNNNNNCTCC	2 cut(s)	448, 478
Bsc4I	CCNNNNNNNGG	1 cut(s)	245
Bse1I	ACTGG	1 cut(s)	153
Bse8I	GATNNNNATC	1 cut(s)	105
BseBI	CCWGG	1 cut(s)	371
BseGI	GGATG	3 cut(s)	208, 338, 442
BseJI	GATNNNNATC	1 cut(s)	105
BseLI	CCNNNNNNNGG	1 cut(s)	245
BseNI	ACTGG	1 cut(s)	153
BseRI	GAGGAG	3 cut(s)	220, 307, 516
BshFI	GGCC	2 cut(s)	250, 326
BslI	CCNNNNNNNGG	1 cut(s)	245
BsnI	GGCC	2 cut(s)	250, 326
Bsp143I	GATC	5 cut(s)	37, 100, 131, 276, 506
BspANI	GGCC	2 cut(s)	250, 326
BspHI	TCATGA	2 cut(s)	10, 115
BspLI	GGNNCC	1 cut(s)	387
BspPI	GGATC	3 cut(s)	45, 271, 514
BspQI	GCTCTTC	1 cut(s)	350
BsrI	ACTGG	1 cut(s)	153
BssMI	GATC	5 cut(s)	37, 100, 131, 276, 506
Bst2UI	CCWGG	1 cut(s)	371
Bst6I	CTCTTC	1 cut(s)	350
BstAPI	GCANNNNNTGC	1 cut(s)	212
BstC8I	GCNNGC	1 cut(s)	60
BstF5I	GGATG	3 cut(s)	208, 338, 442
BstKTI	GATC	5 cut(s)	40, 103, 134, 279, 509
BstMBI	GATC	5 cut(s)	37, 100, 131, 276, 506
BstMWI	GCNNNNNNNGC	1 cut(s)	212
BstNI	CCWGG	1 cut(s)	371
BstNSI	RCATGY	1 cut(s)	62
BstSCI	CCNGG	1 cut(s)	369
BstV2I	GAAGAC	1 cut(s)	372
BstX2I	RGATCY	2 cut(s)	131, 506
BstYI	RGATCY	2 cut(s)	131, 506
BsuRI	GGCC	2 cut(s)	250, 326
BtsCI	GGATG	3 cut(s)	208, 338, 442
BtsIMutI	CAGTG	1 cut(s)	146
Cac8I	GCNNGC	1 cut(s)	60
CciI	TCATGA	2 cut(s)	10, 115
Cfr13I	GGNCC	2 cut(s)	248, 325
CspCI	CAANNNNNGTGG	2 cut(s)	363, 398
CviAII	CATG	6 cut(s)	11, 59, 116, 225, 289, 411
CviJI	RGCY	8 cut(s)	126, 250, 326, 386, 409, 420, 473, 491
CviKI_1	RGCY	8 cut(s)	126, 250, 326, 386, 409, 420, 473, 491
DpnI	GATC	5 cut(s)	39, 102, 133, 278, 508
DpnII	GATC	5 cut(s)	37, 100, 131, 276, 506
Eam1104I	CTCTTC	1 cut(s)	350
EarI	CTCTTC	1 cut(s)	350
EcoRI	GAATTC	1 cut(s)	154
EcoRII	CCWGG	1 cut(s)	369
EcoT22I	ATGCAT	1 cut(s)	208
FaeI	CATG	6 cut(s)	14, 62, 119, 228, 292, 414
FatI	CATG	6 cut(s)	10, 58, 115, 224, 288, 410
FokI	GGATG	3 cut(s)	215, 325, 449
FspBI	CTAG	1 cut(s)	344
GsuI	CTGGAG	1 cut(s)	170
HaeIII	GGCC	2 cut(s)	250, 326
Hin1II	CATG	6 cut(s)	14, 62, 119, 228, 292, 414
HindIII	AAGCTT	1 cut(s)	489
HinfI	GANTC	2 cut(s)	140, 173
HphI	GGTGA	1 cut(s)	228
Hpy188I	TCNGA	2 cut(s)	190, 268
Hpy188III	TCNNGA	4 cut(s)	11, 116, 129, 498
HpyAV	CCTTC	3 cut(s)	249, 373, 390
HpyCH4V	TGCA	2 cut(s)	206, 414
HpyF10VI	GCNNNNNNNGC	1 cut(s)	212
Hsp92II	CATG	6 cut(s)	14, 62, 119, 228, 292, 414
Kzo9I	GATC	5 cut(s)	37, 100, 131, 276, 506
LguI	GCTCTTC	1 cut(s)	350
LmnI	GCTCC	2 cut(s)	233, 391
LpnPI	CCDG	4 cut(s)	62, 134, 356, 383
LweI	GCATC	2 cut(s)	193, 215
MaeI	CTAG	1 cut(s)	344
MaeIII	GTNAC	1 cut(s)	443
MalI	GATC	5 cut(s)	39, 102, 133, 278, 508
MboI	GATC	5 cut(s)	37, 100, 131, 276, 506
MflI	RGATCY	2 cut(s)	131, 506
MluCI	AATT	2 cut(s)	154, 539
Mph1103I	ATGCAT	1 cut(s)	208
MslI	CAYNNNNRTG	1 cut(s)	114
MspR9I	CCNGG	1 cut(s)	371
MvaI	CCWGG	1 cut(s)	371
MwoI	GCNNNNNNNGC	1 cut(s)	212
NdeII	GATC	5 cut(s)	37, 100, 131, 276, 506
NlaIII	CATG	6 cut(s)	14, 62, 119, 228, 292, 414
NlaIV	GGNNCC	1 cut(s)	387
NmuCI	GTSAC	1 cut(s)	443
NsiI	ATGCAT	1 cut(s)	208
NspI	RCATGY	1 cut(s)	62
PaeI	GCATGC	1 cut(s)	62
PagI	TCATGA	2 cut(s)	10, 115
PciSI	GCTCTTC	1 cut(s)	350
PfeI	GAWTC	2 cut(s)	140, 173
Psp6I	CCWGG	1 cut(s)	369
PspGI	CCWGG	1 cut(s)	369
PspN4I	GGNNCC	1 cut(s)	387
PspPI	GGNCC	2 cut(s)	248, 325
PsuI	RGATCY	2 cut(s)	131, 506
RseI	CAYNNNNRTG	1 cut(s)	114
SapI	GCTCTTC	1 cut(s)	350
Sau3AI	GATC	5 cut(s)	37, 100, 131, 276, 506
Sau96I	GGNCC	2 cut(s)	248, 325
ScrFI	CCNGG	1 cut(s)	371
SetI	ASST	8 cut(s)	128, 241, 273, 301, 372, 384, 422, 493
SfaNI	GCATC	2 cut(s)	193, 215
SmiMI	CAYNNNNRTG	1 cut(s)	114
SmlI	CTYRAG	1 cut(s)	127
SmoI	CTYRAG	1 cut(s)	127
SphI	GCATGC	1 cut(s)	62
Sse9I	AATT	2 cut(s)	154, 539
SspI	AATATT	1 cut(s)	311
SspMI	CTAG	1 cut(s)	344
StyD4I	CCNGG	1 cut(s)	369
TasI	AATT	2 cut(s)	154, 539
TfiI	GAWTC	2 cut(s)	140, 173
TscAI	CASTG	1 cut(s)	153
TseFI	GTSAC	1 cut(s)	443
Tsp45I	GTSAC	1 cut(s)	443
TspDTI	ATGAA	5 cut(s)	27, 132, 174, 176, 273
TspRI	CASTG	1 cut(s)	153
XapI	RAATTY	1 cut(s)	154
XceI	RCATGY	1 cut(s)	62
XspI	CTAG	1 cut(s)	344
Zsp2I	ATGCAT	1 cut(s)	208

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.