FvH4_2g13220

Plant invertase/pectin methylesterase inhibitor

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb2
OG0005336
Physical Location & Seq
Reverse (-)
11560075 .. 11560878
804 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_2g13220.t1

Sequence Viewer

Length: 573 bp
ATGGAGTCTCCACTAGGTTTTCTGCCAACCCTGTTCTTCGCTTTTCTGCTTTTTCTTGTGTGTTCTCCTTCATCAACAATTGCAACAACTCGATTTGTCGAAACTGTATGCAATCAAACCACTAATAATTCGGAATGCTTCAAAGTTCTCGAGTCTGATCCTCGGATTGTAGCTGCATCCAACTACAAGGAACTTGCTCCAATTGCTTTGGATTTAGCAATAACGTATGCAATAAACAGTGAAGCTTTCGTGAAGGGATTAAACAACACCAATCCAAGTGAAGCAGTTAAACAATGTGCAGATGCGTACAAATATGTGGTGTTGGACTTCCAGAGTGCCAAAAAGGACCTCAACGATGACCCTATGTCGGCCAACTATGCCGTTACATTGGCTGCTACTGACGATATTGATAGTTGCGAAGCTGCGTTGAAACGTGGTGGTGTTCAAGTTCCTGCAATATCTTCAATAAACCATCTCCTCCACTCAGACCAGTACCTGAATAGAGTCTTAAGAGTCGATGGACCCAGGGCCATAACCTTAAGGGACCCAAAATTTTCTTTTCTTTTTGTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
PMEI

Protein Analysis

191

Amino Acids

20.84

Weight (kDa)

4.99

Isoelectric Point (pI)

35.18

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PMEI PF04043 32 - 147 2.6e-16 Plant invertase/pectin methylesterase inhibitor
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 152
AcoI YGGCCR 1 cut(s) 369
AcsI RAATTY 1 cut(s) 551
AfaI GTAC 2 cut(s) 308, 494
AfiI CCNNNNNNNGG 1 cut(s) 367
AflII CTTAAG 2 cut(s) 508, 538
AgsI TTSAA 4 cut(s) 142, 430, 446, 465
AhdI GACNNNNNGTC 1 cut(s) 364
AjnI CCWGG 1 cut(s) 524
AluBI AGCT 3 cut(s) 173, 245, 422
AluI AGCT 3 cut(s) 173, 245, 422
Alw26I GTCTC 1 cut(s) 12
AlwI GGATC 1 cut(s) 152
AlwNI CAGNNNCTG 1 cut(s) 496
Ama87I CYCGRG 1 cut(s) 149
AoxI GGCC 2 cut(s) 369, 528
ApeKI GCWGC 3 cut(s) 173, 392, 422
ApoI RAATTY 1 cut(s) 551
AspS9I GGNCC 4 cut(s) 346, 521, 528, 544
AvaI CYCGRG 1 cut(s) 149
AvaII GGWCC 3 cut(s) 346, 521, 544
BbvI GCAGC 3 cut(s) 160, 379, 409
BccI CCATC 2 cut(s) 480, 512
BceAI ACGGC 1 cut(s) 365
BciT130I CCWGG 1 cut(s) 526
BcoDI GTCTC 1 cut(s) 12
BfaI CTAG 1 cut(s) 14
BfrI CTTAAG 2 cut(s) 508, 538
BisI GCNGC 3 cut(s) 174, 393, 423
BlsI GCNGC 3 cut(s) 175, 394, 424
Bme1390I CCNGG 1 cut(s) 526
Bme18I GGWCC 3 cut(s) 346, 521, 544
BmeRI GACNNNNNGTC 1 cut(s) 364
BmeT110I CYCGRG 1 cut(s) 149
BmgT120I GGNCC 4 cut(s) 346, 521, 528, 544
BmiI GGNNCC 3 cut(s) 523, 545, 546
BmrFI CCNGG 1 cut(s) 526
BmsI GCATC 2 cut(s) 185, 292
BsaJI CCNNGG 3 cut(s) 161, 524, 525
Bsc4I CCNNNNNNNGG 1 cut(s) 367
Bse1I ACTGG 1 cut(s) 490
BseBI CCWGG 1 cut(s) 526
BseDI CCNNGG 3 cut(s) 161, 524, 525
BseGI GGATG 1 cut(s) 176
BseLI CCNNNNNNNGG 1 cut(s) 367
BseMII CTCAG 1 cut(s) 498
BseNI ACTGG 1 cut(s) 490
BseRI GAGGAG 1 cut(s) 467
BseXI GCAGC 3 cut(s) 160, 379, 409
BsgI GTGCAG 1 cut(s) 318
BshFI GGCC 2 cut(s) 371, 530
BsiHKCI CYCGRG 1 cut(s) 149
BslFI GGGAC 1 cut(s) 557
BslI CCNNNNNNNGG 1 cut(s) 367
BsmAI GTCTC 1 cut(s) 12
BsmFI GGGAC 1 cut(s) 557
BsmI GAATGC 1 cut(s) 140
BsnI GGCC 2 cut(s) 371, 530
BsoBI CYCGRG 1 cut(s) 149
Bsp143I GATC 1 cut(s) 157
BspANI GGCC 2 cut(s) 371, 530
BspCNI CTCAG 1 cut(s) 497
BspLI GGNNCC 3 cut(s) 523, 545, 546
BspPI GGATC 1 cut(s) 152
BspTI CTTAAG 2 cut(s) 508, 538
BsrI ACTGG 1 cut(s) 490
BssECI CCNNGG 3 cut(s) 161, 524, 525
BssMI GATC 1 cut(s) 157
Bst2UI CCWGG 1 cut(s) 526
Bst4CI ACNGT 2 cut(s) 106, 239
BstAFI CTTAAG 2 cut(s) 508, 538
BstDEI CTNAG 1 cut(s) 484
BstF5I GGATG 1 cut(s) 176
BstKTI GATC 1 cut(s) 160
BstMAI GTCTC 1 cut(s) 12
BstMBI GATC 1 cut(s) 157
BstMWI GCNNNNNNNGC 2 cut(s) 203, 377
BstNI CCWGG 1 cut(s) 526
BstSCI CCNGG 1 cut(s) 524
BstV1I GCAGC 3 cut(s) 160, 379, 409
BsuRI GGCC 2 cut(s) 371, 530
BtsCI GGATG 1 cut(s) 176
BtsIMutI CAGTG 1 cut(s) 244
CaiI CAGNNNCTG 1 cut(s) 496
Cfr13I GGNCC 4 cut(s) 346, 521, 528, 544
Csp6I GTAC 2 cut(s) 307, 493
CviJI RGCY 6 cut(s) 173, 245, 371, 392, 422, 530
CviKI_1 RGCY 6 cut(s) 173, 245, 371, 392, 422, 530
CviQI GTAC 2 cut(s) 307, 493
DdeI CTNAG 1 cut(s) 484
DpnI GATC 1 cut(s) 159
DpnII GATC 1 cut(s) 157
DriI GACNNNNNGTC 1 cut(s) 364
EaeI YGGCCR 1 cut(s) 369
Eam1105I GACNNNNNGTC 1 cut(s) 364
Eco47I GGWCC 3 cut(s) 346, 521, 544
Eco88I CYCGRG 1 cut(s) 149
EcoO109I RGGNCCY 2 cut(s) 346, 544
EcoRII CCWGG 1 cut(s) 524
FaiI YATR 6 cut(s) 109, 228, 315, 365, 378, 533
FaqI GGGAC 1 cut(s) 557
Fnu4HI GCNGC 3 cut(s) 174, 393, 423
FokI GGATG 1 cut(s) 163
Fsp4HI GCNGC 3 cut(s) 174, 393, 423
FspBI CTAG 1 cut(s) 14
GluI GCNGC 3 cut(s) 174, 393, 423
HaeIII GGCC 2 cut(s) 371, 530
HindIII AAGCTT 1 cut(s) 243
HinfI GANTC 4 cut(s) 5, 152, 504, 513
Hpy188I TCNGA 4 cut(s) 133, 157, 165, 487
Hpy188III TCNNGA 3 cut(s) 149, 250, 331
HpyAV CCTTC 2 cut(s) 78, 247
HpyCH4III ACNGT 2 cut(s) 106, 239
HpyCH4IV ACGT 2 cut(s) 224, 433
HpyCH4V TGCA 6 cut(s) 83, 111, 176, 230, 299, 455
HpyF10VI GCNNNNNNNGC 2 cut(s) 203, 377
HpyF3I CTNAG 1 cut(s) 484
HpySE526I ACGT 2 cut(s) 224, 433
KflI GGGWCCC 1 cut(s) 544
Kzo9I GATC 1 cut(s) 157
LmnI GCTCC 1 cut(s) 202
LpnPI CCDG 7 cut(s) 44, 344, 465, 503, 509, 511, 538
Lsp1109I GCAGC 3 cut(s) 160, 379, 409
LweI GCATC 2 cut(s) 185, 292
MaeI CTAG 1 cut(s) 14
MaeII ACGT 2 cut(s) 224, 433
MaeIII GTNAC 1 cut(s) 382
MalI GATC 1 cut(s) 159
MboI GATC 1 cut(s) 157
MboII GAAGA 2 cut(s) 28, 453
MfeI CAATTG 2 cut(s) 78, 201
MluCI AATT 4 cut(s) 78, 127, 201, 551
MlyI GAGTC 4 cut(s) 14, 161, 513, 522
MmeI TCCRAC 2 cut(s) 204, 303
MnlI CCTC 3 cut(s) 171, 359, 488
MseI TTAA 4 cut(s) 260, 288, 509, 539
MspCI CTTAAG 2 cut(s) 508, 538
MspR9I CCNGG 1 cut(s) 526
MunI CAATTG 2 cut(s) 78, 201
Mva1269I GAATGC 1 cut(s) 140
MvaI CCWGG 1 cut(s) 526
MwoI GCNNNNNNNGC 2 cut(s) 203, 377
NdeII GATC 1 cut(s) 157
NlaIV GGNNCC 3 cut(s) 523, 545, 546
PaeR7I CTCGAG 1 cut(s) 149
PasI CCCWGGG 1 cut(s) 525
PctI GAATGC 1 cut(s) 140
PkrI GCNGC 3 cut(s) 175, 394, 424
PleI GAGTC 4 cut(s) 13, 160, 512, 521
PpsI GAGTC 4 cut(s) 13, 160, 512, 521
PpuMI RGGWCCY 2 cut(s) 346, 544
Psp5II RGGWCCY 2 cut(s) 346, 544
Psp6I CCWGG 1 cut(s) 524
PspGI CCWGG 1 cut(s) 524
PspN4I GGNNCC 3 cut(s) 523, 545, 546
PspPI GGNCC 4 cut(s) 346, 521, 528, 544
PspPPI RGGWCCY 2 cut(s) 346, 544
PstNI CAGNNNCTG 1 cut(s) 496
RsaI GTAC 2 cut(s) 308, 494
RsaNI GTAC 2 cut(s) 307, 493
SaqAI TTAA 4 cut(s) 260, 288, 509, 539
SatI GCNGC 3 cut(s) 174, 393, 423
Sau3AI GATC 1 cut(s) 157
Sau96I GGNCC 4 cut(s) 346, 521, 528, 544
SchI GAGTC 4 cut(s) 14, 161, 513, 522
ScrFI CCNGG 1 cut(s) 526
SetI ASST 9 cut(s) 19, 175, 227, 247, 351, 424, 436, 498, 539
SfaNI GCATC 2 cut(s) 185, 292
Sfr274I CTCGAG 1 cut(s) 149
SinI GGWCC 3 cut(s) 346, 521, 544
SlaI CTCGAG 1 cut(s) 149
SmlI CTYRAG 3 cut(s) 149, 508, 538
SmoI CTYRAG 3 cut(s) 149, 508, 538
Sse9I AATT 4 cut(s) 78, 127, 201, 551
SspMI CTAG 1 cut(s) 14
StyD4I CCNGG 1 cut(s) 524
TaaI ACNGT 2 cut(s) 106, 239
TaiI ACGT 2 cut(s) 227, 436
TaqI TCGA 4 cut(s) 91, 99, 150, 516
TasI AATT 4 cut(s) 78, 127, 201, 551
Tru1I TTAA 4 cut(s) 260, 288, 509, 539
Tru9I TTAA 4 cut(s) 260, 288, 509, 539
TscAI CASTG 1 cut(s) 244
TseI GCWGC 3 cut(s) 173, 392, 422
TspDTI ATGAA 1 cut(s) 60
TspRI CASTG 1 cut(s) 244
Vha464I CTTAAG 2 cut(s) 508, 538
VpaK11BI GGWCC 3 cut(s) 346, 521, 544
XapI RAATTY 1 cut(s) 551
XhoI CTCGAG 1 cut(s) 149
XspI CTAG 1 cut(s) 14
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.