MD10G1032400.v1.1

Plant invertase/pectin methylesterase inhibitor

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr10
OG0005336
Physical Location & Seq
Reverse (-)
4170898 .. 4171284
387 bp
Loading structure...
UTR
Exon/CDS
Intron
MD10G1032400.v1.1.491

Sequence Viewer

Length: 387 bp
ATGGAAGTTCTGCACTCTGATCCTCGAGTAAAATCGGCATCCACTTACATACTTCTTGCTCAAGTCGCCCTCGACCTAGCCATAGGGAATGCAAAAGATAGCCAAGCATTCATCAACAATTTGCTCAAGAGTGATCCGACGGAGCCTATTAAACAATGTGCTTCTTCATACGAGTTAGTGGTGGCTTCATTCCAAAGCGCCAAAGTTGAGATATACGAGGATCCTTTGACGGCCAACTATGATGTCAAAATTGCGGGCGATGATGCGGGTAACTGCGAAACTGCCTTAAGTTCTAAAGGAGTTAAATATCCTGAATTATCTGCTAGAAACCATGTTGTACTGTTATATAGTAGTATTGGGGATGTAATCACTGGTCAGATTGATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
PMEI

Protein Analysis

129

Amino Acids

13.75

Weight (kDa)

4.66

Isoelectric Point (pI)

26.23

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PMEI PF04043 2 - 102 1.3e-08 Plant invertase/pectin methylesterase inhibitor
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 254, 266
AclWI GGATC 4 cut(s) 14, 128, 215, 228
AcoI YGGCCR 1 cut(s) 231
AfaI GTAC 1 cut(s) 339
AflII CTTAAG 1 cut(s) 286
AlwI GGATC 4 cut(s) 14, 128, 215, 228
Ama87I CYCGRG 1 cut(s) 24
AoxI GGCC 1 cut(s) 231
AspLEI GCGC 1 cut(s) 200
AvaI CYCGRG 1 cut(s) 24
BamHI GGATCC 1 cut(s) 220
BceAI ACGGC 1 cut(s) 246
BfaI CTAG 2 cut(s) 77, 324
BfoI RGCGCY 1 cut(s) 201
BfrI CTTAAG 1 cut(s) 286
BmeT110I CYCGRG 1 cut(s) 24
BmiI GGNNCC 2 cut(s) 144, 222
BmsI GCATC 2 cut(s) 47, 253
BpuEI CTTGAG 2 cut(s) 45, 110
Bse1I ACTGG 1 cut(s) 376
BseGI GGATG 2 cut(s) 38, 367
BseNI ACTGG 1 cut(s) 376
BshFI GGCC 1 cut(s) 233
BsiHKCI CYCGRG 1 cut(s) 24
BsmI GAATGC 2 cut(s) 94, 107
BsnI GGCC 1 cut(s) 233
BsoBI CYCGRG 1 cut(s) 24
Bsp143I GATC 3 cut(s) 19, 133, 220
BspACI CCGC 2 cut(s) 254, 266
BspANI GGCC 1 cut(s) 233
BspLI GGNNCC 2 cut(s) 144, 222
BspPI GGATC 4 cut(s) 14, 128, 215, 228
BspTI CTTAAG 1 cut(s) 286
BsrI ACTGG 1 cut(s) 376
BssMI GATC 3 cut(s) 19, 133, 220
Bst4CI ACNGT 1 cut(s) 342
BstAFI CTTAAG 1 cut(s) 286
BstC8I GCNNGC 1 cut(s) 256
BstF5I GGATG 2 cut(s) 38, 367
BstH2I RGCGCY 1 cut(s) 201
BstHHI GCGC 1 cut(s) 200
BstKTI GATC 3 cut(s) 22, 136, 223
BstMBI GATC 3 cut(s) 19, 133, 220
BstMWI GCNNNNNNNGC 1 cut(s) 65
BstX2I RGATCY 1 cut(s) 220
BstYI RGATCY 1 cut(s) 220
BsuRI GGCC 1 cut(s) 233
BtgZI GCGATG 1 cut(s) 273
BtsCI GGATG 2 cut(s) 38, 367
BtsIMutI CAGTG 1 cut(s) 369
Cac8I GCNNGC 1 cut(s) 256
CfoI GCGC 1 cut(s) 200
Csp6I GTAC 1 cut(s) 338
CviAII CATG 1 cut(s) 332
CviJI RGCY 5 cut(s) 80, 102, 145, 185, 233
CviKI_1 RGCY 5 cut(s) 80, 102, 145, 185, 233
CviQI GTAC 1 cut(s) 338
DpnI GATC 3 cut(s) 21, 135, 222
DpnII GATC 3 cut(s) 19, 133, 220
EaeI YGGCCR 1 cut(s) 231
Eco88I CYCGRG 1 cut(s) 24
FaeI CATG 1 cut(s) 335
FaiI YATR 8 cut(s) 50, 83, 169, 214, 240, 333, 346, 348
FatI CATG 1 cut(s) 331
FauI CCCGC 2 cut(s) 247, 259
FokI GGATG 2 cut(s) 25, 374
FspBI CTAG 2 cut(s) 77, 324
GlaI GCGC 1 cut(s) 199
HaeII RGCGCY 1 cut(s) 201
HaeIII GGCC 1 cut(s) 233
HhaI GCGC 1 cut(s) 200
Hin1II CATG 1 cut(s) 335
Hin6I GCGC 1 cut(s) 198
HinP1I GCGC 1 cut(s) 198
Hpy188I TCNGA 3 cut(s) 19, 138, 378
Hpy188III TCNNGA 2 cut(s) 127, 311
Hpy99I CGWCG 1 cut(s) 142
HpyCH4III ACNGT 1 cut(s) 342
HpyCH4V TGCA 2 cut(s) 13, 92
HpyF10VI GCNNNNNNNGC 1 cut(s) 65
Hsp92II CATG 1 cut(s) 335
HspAI GCGC 1 cut(s) 198
Kzo9I GATC 3 cut(s) 19, 133, 220
LmnI GCTCC 1 cut(s) 142
LpnPI CCDG 2 cut(s) 324, 357
LweI GCATC 2 cut(s) 47, 253
MaeI CTAG 2 cut(s) 77, 324
MaeIII GTNAC 1 cut(s) 269
MalI GATC 3 cut(s) 21, 135, 222
MboI GATC 3 cut(s) 19, 133, 220
MboII GAAGA 1 cut(s) 156
MflI RGATCY 1 cut(s) 220
MluCI AATT 3 cut(s) 118, 249, 314
MmeI TCCRAC 1 cut(s) 161
MnlI CCTC 3 cut(s) 33, 80, 211
MseI TTAA 3 cut(s) 150, 287, 303
MspCI CTTAAG 1 cut(s) 286
Mva1269I GAATGC 2 cut(s) 94, 107
MwoI GCNNNNNNNGC 1 cut(s) 65
NdeII GATC 3 cut(s) 19, 133, 220
NlaIII CATG 1 cut(s) 335
NlaIV GGNNCC 2 cut(s) 144, 222
PaeR7I CTCGAG 1 cut(s) 24
PctI GAATGC 2 cut(s) 94, 107
PspN4I GGNNCC 2 cut(s) 144, 222
PspXI VCTCGAGB 1 cut(s) 24
PsuI RGATCY 1 cut(s) 220
RsaI GTAC 1 cut(s) 339
RsaNI GTAC 1 cut(s) 338
SaqAI TTAA 3 cut(s) 150, 287, 303
Sau3AI GATC 3 cut(s) 19, 133, 220
SetI ASST 1 cut(s) 78
SfaNI GCATC 2 cut(s) 47, 253
Sfr274I CTCGAG 1 cut(s) 24
SlaI CTCGAG 1 cut(s) 24
SmlI CTYRAG 4 cut(s) 24, 60, 125, 286
SmoI CTYRAG 4 cut(s) 24, 60, 125, 286
Sse9I AATT 3 cut(s) 118, 249, 314
SsiI CCGC 2 cut(s) 254, 266
SspMI CTAG 2 cut(s) 77, 324
TaaI ACNGT 1 cut(s) 342
TaqI TCGA 2 cut(s) 25, 72
TasI AATT 3 cut(s) 118, 249, 314
TatI WGTACW 1 cut(s) 337
Tru1I TTAA 3 cut(s) 150, 287, 303
Tru9I TTAA 3 cut(s) 150, 287, 303
TscAI CASTG 1 cut(s) 376
TspDTI ATGAA 3 cut(s) 100, 156, 177
TspGWI ACGGA 1 cut(s) 155
TspRI CASTG 1 cut(s) 376
Vha464I CTTAAG 1 cut(s) 286
XhoI CTCGAG 1 cut(s) 24
XspI CTAG 2 cut(s) 77, 324
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.