FvH4_7g08800

Protein TRIGALACTOSYLDIACYLGLYCEROL 4, chloroplastic

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb7
Physical Location & Seq
Forward (+)
8618227 .. 8620101
1875 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_7g08800.t1

Sequence Viewer

Length: 219 bp
ATGTATGATACTGTTGCTGAACCTCATGCTGCAGTATCTGGAATTTTTGGTTGTGGGGCTAATTGTCTTCCGAGTGGTTCAAGGGTTTCACTTGCCTCTTTGCCTGGCAAACGTGGCCCACATATTGAGGATTTCATTTACAGCTTGAGCTACTCTTTGAGGCTTCTACAGTCAGGCAGGGTCGTTGCTTGGTTTTCCCTGGAAAGAAAGAAGGAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

73

Amino Acids

7.83

Weight (kDa)

8.74

Isoelectric Point (pI)

56.95

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 42
AgsI TTSAA 1 cut(s) 81
AjnI CCWGG 2 cut(s) 103, 198
AluBI AGCT 2 cut(s) 144, 150
AluI AGCT 2 cut(s) 144, 150
AlwNI CAGNNNCTG 1 cut(s) 38
AoxI GGCC 1 cut(s) 115
ApeKI GCWGC 1 cut(s) 29
ApoI RAATTY 1 cut(s) 42
AspS9I GGNCC 1 cut(s) 116
BbsI GAAGAC 1 cut(s) 59
BbvI GCAGC 1 cut(s) 16
BciT130I CCWGG 2 cut(s) 105, 200
BfmI CTRYAG 2 cut(s) 30, 167
BisI GCNGC 1 cut(s) 30
BlsI GCNGC 1 cut(s) 31
Bme1390I CCNGG 2 cut(s) 105, 200
BmgT120I GGNCC 1 cut(s) 116
BmrFI CCNGG 2 cut(s) 105, 200
BpiI GAAGAC 1 cut(s) 59
BpuEI CTTGAG 1 cut(s) 166
BsaJI CCNNGG 1 cut(s) 198
BseBI CCWGG 2 cut(s) 105, 200
BseDI CCNNGG 1 cut(s) 198
BseXI GCAGC 1 cut(s) 16
BshFI GGCC 1 cut(s) 117
BsnI GGCC 1 cut(s) 117
BspANI GGCC 1 cut(s) 117
BspMAI CTGCAG 1 cut(s) 34
BssECI CCNNGG 1 cut(s) 198
Bst2UI CCWGG 2 cut(s) 105, 200
Bst4CI ACNGT 2 cut(s) 13, 171
BstMWI GCNNNNNNNGC 1 cut(s) 114
BstNI CCWGG 2 cut(s) 105, 200
BstSCI CCNGG 2 cut(s) 103, 198
BstSFI CTRYAG 2 cut(s) 30, 167
BstV1I GCAGC 1 cut(s) 16
BstV2I GAAGAC 1 cut(s) 59
BsuRI GGCC 1 cut(s) 117
CaiI CAGNNNCTG 1 cut(s) 38
Cfr13I GGNCC 1 cut(s) 116
CviAII CATG 1 cut(s) 26
CviJI RGCY 5 cut(s) 59, 117, 144, 150, 163
CviKI_1 RGCY 5 cut(s) 59, 117, 144, 150, 163
EcoRII CCWGG 2 cut(s) 103, 198
FaeI CATG 1 cut(s) 29
FaiI YATR 3 cut(s) 6, 27, 123
FatI CATG 1 cut(s) 25
Fnu4HI GCNGC 1 cut(s) 30
Fsp4HI GCNGC 1 cut(s) 30
GluI GCNGC 1 cut(s) 30
HaeIII GGCC 1 cut(s) 117
Hin1II CATG 1 cut(s) 29
Hpy188I TCNGA 1 cut(s) 72
Hpy188III TCNNGA 1 cut(s) 39
HpyAV CCTTC 1 cut(s) 205
HpyCH4III ACNGT 2 cut(s) 13, 171
HpyCH4IV ACGT 1 cut(s) 112
HpyCH4V TGCA 1 cut(s) 32
HpyF10VI GCNNNNNNNGC 1 cut(s) 114
HpySE526I ACGT 1 cut(s) 112
Hsp92II CATG 1 cut(s) 29
LpnPI CCDG 7 cut(s) 24, 90, 117, 159, 163, 185, 212
Lsp1109I GCAGC 1 cut(s) 16
MaeII ACGT 1 cut(s) 112
MboII GAAGA 1 cut(s) 59
MluCI AATT 2 cut(s) 42, 61
MnlI CCTC 4 cut(s) 33, 106, 121, 153
MspR9I CCNGG 2 cut(s) 105, 200
MvaI CCWGG 2 cut(s) 105, 200
MwoI GCNNNNNNNGC 1 cut(s) 114
NlaIII CATG 1 cut(s) 29
PkrI GCNGC 1 cut(s) 31
Psp6I CCWGG 2 cut(s) 103, 198
PspGI CCWGG 2 cut(s) 103, 198
PspPI GGNCC 1 cut(s) 116
PstI CTGCAG 1 cut(s) 34
PstNI CAGNNNCTG 1 cut(s) 38
SatI GCNGC 1 cut(s) 30
Sau96I GGNCC 1 cut(s) 116
ScrFI CCNGG 2 cut(s) 105, 200
SetI ASST 4 cut(s) 25, 115, 146, 152
SfcI CTRYAG 2 cut(s) 30, 167
SmlI CTYRAG 1 cut(s) 145
SmoI CTYRAG 1 cut(s) 145
Sse9I AATT 2 cut(s) 42, 61
StyD4I CCNGG 2 cut(s) 103, 198
TaaI ACNGT 2 cut(s) 13, 171
TaiI ACGT 1 cut(s) 115
TasI AATT 2 cut(s) 42, 61
TseI GCWGC 1 cut(s) 29
TspDTI ATGAA 1 cut(s) 124
XapI RAATTY 1 cut(s) 42
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.