Basic Information

Type: gene

Biological Identity

Species

malus_domestica

Chromosome

Chr07

Orthogroup ID

OG0002739

Physical Location & Seq

Genomic Coordinates Forward (+)

9359287 .. 9360284

Gene Structure 998 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

MD07G1089900.v1.1.491

Sequence Viewer

CDS Protein Promoter (2k)

Length: 303 bp

ATGCCTGGATTCTGCGCAAAGGCTGCCTTTTCTTTTGAAAAAAGCCAAGATCTTTGGAGGCAAAATGAGACACAAAAAGACATCATGATACAGAAAGAAAAGGGTTGGTTTTGGCGGCCATCTTATGATGTGCGGCTTAAAGAATCTCATGCTGCAGTATCTCGAATTTTTGGTGGAAGCTGCACTGCCTGGTTTCAGGATGGGTACAACCAAGTGGCAGTTGATATGAGGGGAGACGAGGGCAATTCTAGGAGCAATAAGAAGAGAAGTCCATTCCATGCTGATTTTTTCGGCTGTCTCTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DUF3769

Protein Analysis

101

Amino Acids

11.56

Weight (kDa)

8.88

Isoelectric Point (pI)

57.65

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002739)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G44640
fragaria_vesca	FvH4_7g08780 FvH4_7g08780 FvH4_7g08780 FvH4_7g08800
malus_domestica	MD02G1224900.v1.1 MD07G1088800.v1.1 MD07G1089000.v1.1 MD07G1089100.v1.1 MD07G1089700.v1.1 MD07G1089800.v1.1 MD07G1089900.v1.1 MD07G1090600.v1.1
prunus_persica	Prupe.2G115700_v2.0.a1 Prupe.2G115700_v2.0.a1
pyrus_communis	pycom02g17920 pycom02g17930 pycom02g19310 pycom07g07130
rosa_chinensis	RchiOBHm_Chr1g0344071
rosa_laevigata	RLG00000028928
rosa_multiflora	Rmu_sc0000251.1_g000013 Rmu_sc0000251.1_g000017 Rmu_sc0002276.1_g000004 Rmu_sc0002276.1_g000007 Rmu_sc0002297.1_g000007 Rmu_sc0002297.1_g000013 Rmu_ssc0000434.1_g000008
rosa_roxburghii	Rroxscaffold_4G00310080
rosa_rugosa	Rorug01G0171400 Rorug01G0171500 Rorug05G0553700 Rorug05G0553800
rosa_samantha	Rh1AG188100 Rh1BG154200 Rh1CG173600 Rh1DG186300 Rh5BG101000
rosa_wichuraiana	Rw1G015480

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc16I	TGCGCA	1 cut(s)	16
AciI	CCGC	2 cut(s)	115, 133
AcoI	YGGCCR	1 cut(s)	116
AcsI	RAATTY	1 cut(s)	165
AfaI	GTAC	1 cut(s)	206
AgsI	TTSAA	1 cut(s)	38
AjnI	CCWGG	2 cut(s)	4, 188
AluBI	AGCT	1 cut(s)	180
AluI	AGCT	1 cut(s)	180
Alw26I	GTCTC	2 cut(s)	62, 228
AoxI	GGCC	1 cut(s)	116
ApeKI	GCWGC	3 cut(s)	23, 152, 180
ApoI	RAATTY	1 cut(s)	165
AspLEI	GCGC	1 cut(s)	17
BbvI	GCAGC	3 cut(s)	10, 139, 167
BccI	CCATC	2 cut(s)	127, 194
BciT130I	CCWGG	2 cut(s)	6, 190
BcoDI	GTCTC	2 cut(s)	62, 228
BfaI	CTAG	1 cut(s)	249
BfmI	CTRYAG	1 cut(s)	153
BglII	AGATCT	1 cut(s)	49
BisI	GCNGC	5 cut(s)	24, 116, 134, 153, 181
BlsI	GCNGC	5 cut(s)	25, 117, 135, 154, 182
Bme1390I	CCNGG	2 cut(s)	6, 190
BmrFI	CCNGG	2 cut(s)	6, 190
BseBI	CCWGG	2 cut(s)	6, 190
BseGI	GGATG	1 cut(s)	205
BseXI	GCAGC	3 cut(s)	10, 139, 167
BsgI	GTGCAG	1 cut(s)	166
BshFI	GGCC	1 cut(s)	118
BsmAI	GTCTC	2 cut(s)	62, 228
BsmBI	CGTCTC	1 cut(s)	228
BsnI	GGCC	1 cut(s)	118
Bsp143I	GATC	1 cut(s)	49
BspACI	CCGC	2 cut(s)	115, 133
BspANI	GGCC	1 cut(s)	118
BspHI	TCATGA	1 cut(s)	84
BspMAI	CTGCAG	1 cut(s)	157
BssMI	GATC	1 cut(s)	49
Bst2UI	CCWGG	2 cut(s)	6, 190
Bst6I	CTCTTC	1 cut(s)	257
BstAPI	GCANNNNNTGC	1 cut(s)	23
BstF5I	GGATG	1 cut(s)	205
BstHHI	GCGC	1 cut(s)	17
BstKTI	GATC	1 cut(s)	52
BstMAI	GTCTC	2 cut(s)	62, 228
BstMBI	GATC	1 cut(s)	49
BstMWI	GCNNNNNNNGC	1 cut(s)	23
BstNI	CCWGG	2 cut(s)	6, 190
BstSCI	CCNGG	2 cut(s)	4, 188
BstSFI	CTRYAG	1 cut(s)	153
BstV1I	GCAGC	3 cut(s)	10, 139, 167
BstX2I	RGATCY	1 cut(s)	49
BstYI	RGATCY	1 cut(s)	49
BsuRI	GGCC	1 cut(s)	118
BtsCI	GGATG	1 cut(s)	205
BtsI	GCAGTG	1 cut(s)	183
BtsIMutI	CAGTG	1 cut(s)	183
CciI	TCATGA	1 cut(s)	84
CfoI	GCGC	1 cut(s)	17
Csp6I	GTAC	1 cut(s)	205
CviAII	CATG	3 cut(s)	85, 149, 278
CviJI	RGCY	6 cut(s)	23, 45, 118, 136, 180, 294
CviKI_1	RGCY	6 cut(s)	23, 45, 118, 136, 180, 294
CviQI	GTAC	1 cut(s)	205
DpnI	GATC	1 cut(s)	51
DpnII	GATC	1 cut(s)	49
EaeI	YGGCCR	1 cut(s)	116
Eam1104I	CTCTTC	1 cut(s)	257
EarI	CTCTTC	1 cut(s)	257
EcoRII	CCWGG	2 cut(s)	4, 188
Esp3I	CGTCTC	1 cut(s)	228
FaeI	CATG	3 cut(s)	88, 152, 281
FaiI	YATR	5 cut(s)	86, 126, 150, 227, 279
FalI	AAGNNNNNCTT	2 cut(s)	11, 43
FatI	CATG	3 cut(s)	84, 148, 277
Fnu4HI	GCNGC	5 cut(s)	24, 116, 134, 153, 181
FokI	GGATG	1 cut(s)	212
Fsp4HI	GCNGC	5 cut(s)	24, 116, 134, 153, 181
FspBI	CTAG	1 cut(s)	249
FspI	TGCGCA	1 cut(s)	16
GlaI	GCGC	1 cut(s)	16
GluI	GCNGC	5 cut(s)	24, 116, 134, 153, 181
HaeIII	GGCC	1 cut(s)	118
HhaI	GCGC	1 cut(s)	17
Hin1II	CATG	3 cut(s)	88, 152, 281
Hin6I	GCGC	1 cut(s)	15
HinP1I	GCGC	1 cut(s)	15
HinfI	GANTC	2 cut(s)	9, 143
Hpy188I	TCNGA	1 cut(s)	302
Hpy188III	TCNNGA	3 cut(s)	85, 162, 197
HpyCH4V	TGCA	2 cut(s)	155, 183
HpyF10VI	GCNNNNNNNGC	1 cut(s)	23
Hsp92II	CATG	3 cut(s)	88, 152, 281
HspAI	GCGC	1 cut(s)	15
Kzo9I	GATC	1 cut(s)	49
LmnI	GCTCC	1 cut(s)	252
LpnPI	CCDG	4 cut(s)	18, 175, 182, 202
Lsp1109I	GCAGC	3 cut(s)	10, 139, 167
MaeI	CTAG	1 cut(s)	249
MalI	GATC	1 cut(s)	51
MboI	GATC	1 cut(s)	49
MboII	GAAGA	1 cut(s)	274
MflI	RGATCY	1 cut(s)	49
MluCI	AATT	2 cut(s)	165, 244
MnlI	CCTC	3 cut(s)	51, 222, 232
MseI	TTAA	1 cut(s)	138
MspR9I	CCNGG	2 cut(s)	6, 190
MvaI	CCWGG	2 cut(s)	6, 190
MwoI	GCNNNNNNNGC	1 cut(s)	23
NdeII	GATC	1 cut(s)	49
NlaIII	CATG	3 cut(s)	88, 152, 281
NsbI	TGCGCA	1 cut(s)	16
PagI	TCATGA	1 cut(s)	84
PfeI	GAWTC	2 cut(s)	9, 143
PkrI	GCNGC	5 cut(s)	25, 117, 135, 154, 182
Psp6I	CCWGG	2 cut(s)	4, 188
PspGI	CCWGG	2 cut(s)	4, 188
PstI	CTGCAG	1 cut(s)	157
PsuI	RGATCY	1 cut(s)	49
RsaI	GTAC	1 cut(s)	206
RsaNI	GTAC	1 cut(s)	205
SaqAI	TTAA	1 cut(s)	138
SatI	GCNGC	5 cut(s)	24, 116, 134, 153, 181
Sau3AI	GATC	1 cut(s)	49
ScrFI	CCNGG	2 cut(s)	6, 190
SetI	ASST	1 cut(s)	182
SfcI	CTRYAG	1 cut(s)	153
Sse9I	AATT	2 cut(s)	165, 244
SsiI	CCGC	2 cut(s)	115, 133
SspMI	CTAG	1 cut(s)	249
StyD4I	CCNGG	2 cut(s)	4, 188
TaqI	TCGA	1 cut(s)	163
TasI	AATT	2 cut(s)	165, 244
TauI	GCSGC	2 cut(s)	118, 136
TfiI	GAWTC	2 cut(s)	9, 143
Tru1I	TTAA	1 cut(s)	138
Tru9I	TTAA	1 cut(s)	138
TscAI	CASTG	1 cut(s)	190
TseI	GCWGC	3 cut(s)	23, 152, 180
TspRI	CASTG	1 cut(s)	190
XapI	RAATTY	1 cut(s)	165
XspI	CTAG	1 cut(s)	249

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.