Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002297.1

Orthogroup ID

OG0002739

Physical Location & Seq

Genomic Coordinates Forward (+)

53241 .. 54219

Gene Structure 979 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002297.1_g000013.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 456 bp

atgggaacactttttcaagtactaagaagagaagtcctgtcagtgactgctgattgttttggttcaatttgctatcgcttccagcatgggaaatttcgagagctttatggggatcttaccaggatagatgctcgcctggatattggttcagcttcagctcttgctaaaagggttgtcaatggcttcaagagttcctctggtaatagtgctatagatcctatatcctcccctaggatcaatctaatctttcaacagcaggttgtggggccaattgtctttcgagcggattcaagggtttcactagcctctttgcctgggaaacgtggtccacatattgaggatttcatttacagcttgagctactccttgaggcttttacagtcgggcaaggttgttgcttggtattccccgaaaagaaaagaaggaatgattgagttgcgggtgtttgagttttaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DUF3769

Protein Analysis

151

Amino Acids

16.92

Weight (kDa)

9.87

Isoelectric Point (pI)

42.02

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002739)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G44640
fragaria_vesca	FvH4_7g08780 FvH4_7g08780 FvH4_7g08780 FvH4_7g08800
malus_domestica	MD02G1224900.v1.1 MD07G1088800.v1.1 MD07G1089000.v1.1 MD07G1089100.v1.1 MD07G1089700.v1.1 MD07G1089800.v1.1 MD07G1089900.v1.1 MD07G1090600.v1.1
prunus_persica	Prupe.2G115700_v2.0.a1 Prupe.2G115700_v2.0.a1
pyrus_communis	pycom02g17920 pycom02g17930 pycom02g19310 pycom07g07130
rosa_chinensis	RchiOBHm_Chr1g0344071
rosa_laevigata	RLG00000028928
rosa_multiflora	Rmu_sc0000251.1_g000013 Rmu_sc0000251.1_g000017 Rmu_sc0002276.1_g000004 Rmu_sc0002276.1_g000007 Rmu_sc0002297.1_g000007 Rmu_sc0002297.1_g000013 Rmu_ssc0000434.1_g000008
rosa_roxburghii	Rroxscaffold_4G00310080
rosa_rugosa	Rorug01G0171400 Rorug01G0171500 Rorug05G0553700 Rorug05G0553800
rosa_samantha	Rh1AG188100 Rh1BG154200 Rh1CG173600 Rh1DG186300 Rh5BG101000
rosa_wichuraiana	Rw1G015480

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	247
AccBSI	CCGCTC	1 cut(s)	284
AciI	CCGC	2 cut(s)	284, 439
AclWI	GGATC	3 cut(s)	120, 209, 242
AcsI	RAATTY	1 cut(s)	92
AcuI	CTGAAG	1 cut(s)	138
AfaI	GTAC	1 cut(s)	21
AfiI	CCNNNNNNNGG	1 cut(s)	231
AgsI	TTSAA	5 cut(s)	17, 66, 187, 251, 291
AjnI	CCWGG	3 cut(s)	119, 135, 313
AluBI	AGCT	5 cut(s)	103, 152, 158, 354, 360
AluI	AGCT	5 cut(s)	103, 152, 158, 354, 360
AlwI	GGATC	3 cut(s)	120, 209, 242
AlwNI	CAGNNNCTG	1 cut(s)	47
AoxI	GGCC	1 cut(s)	266
ApoI	RAATTY	1 cut(s)	92
AspA2I	CCTAGG	1 cut(s)	230
AspS9I	GGNCC	2 cut(s)	266, 326
AvaII	GGWCC	1 cut(s)	326
AvrII	CCTAGG	1 cut(s)	230
BciT130I	CCWGG	3 cut(s)	121, 137, 315
BfaI	CTAG	2 cut(s)	231, 302
BfmI	CTRYAG	1 cut(s)	210
BfuAI	ACCTGC	1 cut(s)	247
BlnI	CCTAGG	1 cut(s)	230
BmcAI	AGTACT	1 cut(s)	21
Bme1390I	CCNGG	3 cut(s)	121, 137, 315
Bme18I	GGWCC	1 cut(s)	326
BmgT120I	GGNCC	2 cut(s)	266, 326
BmiI	GGNNCC	1 cut(s)	267
BmrFI	CCNGG	3 cut(s)	121, 137, 315
BmsI	GCATC	1 cut(s)	118
BpuEI	CTTGAG	2 cut(s)	376, 388
BsaJI	CCNNGG	2 cut(s)	230, 314
Bsc4I	CCNNNNNNNGG	1 cut(s)	231
BseBI	CCWGG	3 cut(s)	121, 137, 315
BseDI	CCNNGG	2 cut(s)	230, 314
BseLI	CCNNNNNNNGG	1 cut(s)	231
BshFI	GGCC	1 cut(s)	268
BslI	CCNNNNNNNGG	1 cut(s)	231
BsnI	GGCC	1 cut(s)	268
Bsp143I	GATC	3 cut(s)	112, 214, 234
BspACI	CCGC	2 cut(s)	284, 439
BspANI	GGCC	1 cut(s)	268
BspLI	GGNNCC	1 cut(s)	267
BspMI	ACCTGC	1 cut(s)	247
BspPI	GGATC	3 cut(s)	120, 209, 242
BsrBI	CCGCTC	1 cut(s)	284
BssECI	CCNNGG	2 cut(s)	230, 314
BssMI	GATC	3 cut(s)	112, 214, 234
BssT1I	CCWWGG	1 cut(s)	230
Bst2UI	CCWGG	3 cut(s)	121, 137, 315
Bst4CI	ACNGT	1 cut(s)	381
Bst6I	CTCTTC	1 cut(s)	22
BstC8I	GCNNGC	1 cut(s)	133
BstDEI	CTNAG	1 cut(s)	23
BstENI	CCTNNNNNAGG	1 cut(s)	229
BstKTI	GATC	3 cut(s)	115, 217, 237
BstMBI	GATC	3 cut(s)	112, 214, 234
BstNI	CCWGG	3 cut(s)	121, 137, 315
BstSCI	CCNGG	3 cut(s)	119, 135, 313
BstSFI	CTRYAG	1 cut(s)	210
BstX2I	RGATCY	2 cut(s)	112, 214
BstYI	RGATCY	2 cut(s)	112, 214
BsuRI	GGCC	1 cut(s)	268
BtsIMutI	CAGTG	1 cut(s)	48
BveI	ACCTGC	1 cut(s)	247
Cac8I	GCNNGC	1 cut(s)	133
CaiI	CAGNNNCTG	1 cut(s)	47
Cfr13I	GGNCC	2 cut(s)	266, 326
Csp6I	GTAC	1 cut(s)	20
CviAII	CATG	1 cut(s)	86
CviJI	RGCY	9 cut(s)	103, 152, 158, 183, 268, 305, 354, 360, 373
CviKI_1	RGCY	9 cut(s)	103, 152, 158, 183, 268, 305, 354, 360, 373
CviQI	GTAC	1 cut(s)	20
DdeI	CTNAG	1 cut(s)	23
DpnI	GATC	3 cut(s)	114, 216, 236
DpnII	GATC	3 cut(s)	112, 214, 234
Eam1104I	CTCTTC	1 cut(s)	22
EarI	CTCTTC	1 cut(s)	22
Eco130I	CCWWGG	1 cut(s)	230
Eco47I	GGWCC	1 cut(s)	326
Eco57I	CTGAAG	1 cut(s)	138
EcoNI	CCTNNNNNAGG	1 cut(s)	229
EcoRII	CCWGG	3 cut(s)	119, 135, 313
EcoT14I	CCWWGG	1 cut(s)	230
ErhI	CCWWGG	1 cut(s)	230
FaeI	CATG	1 cut(s)	89
FaiI	YATR	5 cut(s)	87, 108, 212, 221, 333
FatI	CATG	1 cut(s)	85
FauI	CCCGC	1 cut(s)	432
FspBI	CTAG	2 cut(s)	231, 302
HaeIII	GGCC	1 cut(s)	268
Hin1II	CATG	1 cut(s)	89
HinfI	GANTC	1 cut(s)	287
Hpy166II	GTNNAC	1 cut(s)	329
Hpy188III	TCNNGA	2 cut(s)	98, 187
Hpy8I	GTNNAC	1 cut(s)	329
HpyAV	CCTTC	1 cut(s)	416
HpyCH4III	ACNGT	1 cut(s)	381
HpyCH4IV	ACGT	1 cut(s)	322
HpyF3I	CTNAG	1 cut(s)	23
HpySE526I	ACGT	1 cut(s)	322
Hsp92II	CATG	1 cut(s)	89
Kzo9I	GATC	3 cut(s)	112, 214, 234
LweI	GCATC	1 cut(s)	118
MaeI	CTAG	2 cut(s)	231, 302
MaeII	ACGT	1 cut(s)	322
MaeIII	GTNAC	1 cut(s)	43
MalI	GATC	3 cut(s)	114, 216, 236
MbiI	CCGCTC	1 cut(s)	284
MboI	GATC	3 cut(s)	112, 214, 234
MboII	GAAGA	1 cut(s)	39
MfeI	CAATTG	1 cut(s)	270
MflI	RGATCY	2 cut(s)	112, 214
MluCI	AATT	3 cut(s)	66, 92, 270
MnlI	CCTC	5 cut(s)	205, 235, 316, 331, 363
MseI	TTAA	1 cut(s)	454
MspR9I	CCNGG	3 cut(s)	121, 137, 315
MunI	CAATTG	1 cut(s)	270
MvaI	CCWGG	3 cut(s)	121, 137, 315
NdeII	GATC	3 cut(s)	112, 214, 234
NlaIII	CATG	1 cut(s)	89
NlaIV	GGNNCC	1 cut(s)	267
NmuCI	GTSAC	1 cut(s)	43
PfeI	GAWTC	1 cut(s)	287
Psp6I	CCWGG	3 cut(s)	119, 135, 313
PspGI	CCWGG	3 cut(s)	119, 135, 313
PspN4I	GGNNCC	1 cut(s)	267
PspPI	GGNCC	2 cut(s)	266, 326
PstNI	CAGNNNCTG	1 cut(s)	47
PsuI	RGATCY	2 cut(s)	112, 214
RsaI	GTAC	1 cut(s)	21
RsaNI	GTAC	1 cut(s)	20
SaqAI	TTAA	1 cut(s)	454
Sau3AI	GATC	3 cut(s)	112, 214, 234
Sau96I	GGNCC	2 cut(s)	266, 326
ScaI	AGTACT	1 cut(s)	21
ScrFI	CCNGG	3 cut(s)	121, 137, 315
SetI	ASST	8 cut(s)	105, 154, 160, 261, 325, 356, 362, 393
SfaNI	GCATC	1 cut(s)	118
SfcI	CTRYAG	1 cut(s)	210
SinI	GGWCC	1 cut(s)	326
SmlI	CTYRAG	2 cut(s)	355, 367
SmoI	CTYRAG	2 cut(s)	355, 367
Sse9I	AATT	3 cut(s)	66, 92, 270
SsiI	CCGC	2 cut(s)	284, 439
SspMI	CTAG	2 cut(s)	231, 302
StyD4I	CCNGG	3 cut(s)	119, 135, 313
StyI	CCWWGG	1 cut(s)	230
TaaI	ACNGT	1 cut(s)	381
TaiI	ACGT	1 cut(s)	325
TaqI	TCGA	2 cut(s)	97, 280
TasI	AATT	3 cut(s)	66, 92, 270
TatI	WGTACW	1 cut(s)	19
TfiI	GAWTC	1 cut(s)	287
Tru1I	TTAA	1 cut(s)	454
Tru9I	TTAA	1 cut(s)	454
TscAI	CASTG	1 cut(s)	48
TseFI	GTSAC	1 cut(s)	43
Tsp45I	GTSAC	1 cut(s)	43
TspDTI	ATGAA	1 cut(s)	334
TspRI	CASTG	1 cut(s)	48
VpaK11BI	GGWCC	1 cut(s)	326
XagI	CCTNNNNNAGG	1 cut(s)	229
XapI	RAATTY	1 cut(s)	92
XmaJI	CCTAGG	1 cut(s)	230
XspI	CTAG	2 cut(s)	231, 302
ZrmI	AGTACT	1 cut(s)	21

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.