MD10G1234500.v1.1

gag-polypeptide of LTR copia-type

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr10
OG0002235
Physical Location & Seq
Forward (+)
33060283 .. 33061586
1304 bp
Loading structure...
UTR
Exon/CDS
Intron
MD10G1234500.v1.1.491

Sequence Viewer

Length: 270 bp
ATGGAGCTGATTTTGAATGGTGTTGGTCCTGCTTTCGAAAGTATAGTTACTTCGATTCAAGCAAGAGAAAATCCTATGAGTCTTGACGATATGGTTGCTTTGCTCTTAAGCGCTGAAAGCCGTATGGACGACTATAGCACTACTTTCAGTCCTGATCACACCACAACAGCTCTCTTTGCCCCTTCTGGCTCCACTCCCAATCCTGGTCGTGGAACCACACTTCACCGAGGACATGGTCGTACATCCTCATTCCGTCGTGGTGGTTTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Retrotran_gag_2 Retrotran_gag_3

Protein Analysis

90

Amino Acids

9.54

Weight (kDa)

5.8

Isoelectric Point (pI)

33.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 241
AfeI AGCGCT 1 cut(s) 112
AfiI CCNNNNNNNGG 2 cut(s) 203, 209
AflII CTTAAG 1 cut(s) 106
AgsI TTSAA 2 cut(s) 16, 59
AjnI CCWGG 1 cut(s) 202
AluBI AGCT 2 cut(s) 7, 170
AluI AGCT 2 cut(s) 7, 170
Aor51HI AGCGCT 1 cut(s) 112
AspLEI GCGC 1 cut(s) 113
AspS9I GGNCC 1 cut(s) 26
AsuHPI GGTGA 1 cut(s) 215
AsuII TTCGAA 1 cut(s) 36
AvaII GGWCC 1 cut(s) 26
BarI GAAGNNNNNNTAC 2 cut(s) 34, 66
BceAI ACGGC 1 cut(s) 105
BcgI CGANNNNNNTGC 2 cut(s) 77, 111
BciT130I CCWGG 1 cut(s) 204
BclI TGATCA 1 cut(s) 154
BfmI CTRYAG 1 cut(s) 133
BfoI RGCGCY 1 cut(s) 114
BfrI CTTAAG 1 cut(s) 106
Bme1390I CCNGG 1 cut(s) 204
Bme18I GGWCC 1 cut(s) 26
BmgT120I GGNCC 1 cut(s) 26
BmiI GGNNCC 2 cut(s) 190, 214
BmrFI CCNGG 1 cut(s) 204
Bpu14I TTCGAA 1 cut(s) 36
BsaJI CCNNGG 1 cut(s) 226
Bsc4I CCNNNNNNNGG 2 cut(s) 203, 209
BseBI CCWGG 1 cut(s) 204
BseDI CCNNGG 1 cut(s) 226
BseGI GGATG 1 cut(s) 242
BseLI CCNNNNNNNGG 2 cut(s) 203, 209
BslI CCNNNNNNNGG 2 cut(s) 203, 209
Bsp119I TTCGAA 1 cut(s) 36
Bsp143I GATC 1 cut(s) 154
BspLI GGNNCC 2 cut(s) 190, 214
BspT104I TTCGAA 1 cut(s) 36
BspTI CTTAAG 1 cut(s) 106
BssECI CCNNGG 1 cut(s) 226
BssMI GATC 1 cut(s) 154
Bst2UI CCWGG 1 cut(s) 204
BstAFI CTTAAG 1 cut(s) 106
BstBI TTCGAA 1 cut(s) 36
BstF5I GGATG 1 cut(s) 242
BstH2I RGCGCY 1 cut(s) 114
BstHHI GCGC 1 cut(s) 113
BstKTI GATC 1 cut(s) 157
BstMBI GATC 1 cut(s) 154
BstMWI GCNNNNNNNGC 2 cut(s) 117, 176
BstNI CCWGG 1 cut(s) 204
BstSCI CCNGG 1 cut(s) 202
BstSFI CTRYAG 1 cut(s) 133
BtsCI GGATG 1 cut(s) 242
CfoI GCGC 1 cut(s) 113
Cfr13I GGNCC 1 cut(s) 26
Csp6I GTAC 1 cut(s) 240
CviAII CATG 1 cut(s) 233
CviJI RGCY 4 cut(s) 7, 120, 170, 189
CviKI_1 RGCY 4 cut(s) 7, 120, 170, 189
CviQI GTAC 1 cut(s) 240
DpnI GATC 1 cut(s) 156
DpnII GATC 1 cut(s) 154
Eco47I GGWCC 1 cut(s) 26
Eco47III AGCGCT 1 cut(s) 112
EcoRII CCWGG 1 cut(s) 202
FaeI CATG 1 cut(s) 236
FaiI YATR 6 cut(s) 44, 77, 92, 125, 135, 234
FatI CATG 1 cut(s) 232
FbaI TGATCA 1 cut(s) 154
FokI GGATG 1 cut(s) 229
GlaI GCGC 1 cut(s) 112
HaeII RGCGCY 1 cut(s) 114
HhaI GCGC 1 cut(s) 113
Hin1II CATG 1 cut(s) 236
Hin6I GCGC 1 cut(s) 111
HinP1I GCGC 1 cut(s) 111
HinfI GANTC 2 cut(s) 55, 79
HphI GGTGA 1 cut(s) 215
Hpy188III TCNNGA 2 cut(s) 83, 152
Hpy99I CGWCG 1 cut(s) 258
HpyAV CCTTC 1 cut(s) 192
HpyF10VI GCNNNNNNNGC 2 cut(s) 117, 176
Hsp92II CATG 1 cut(s) 236
HspAI GCGC 1 cut(s) 111
Ksp22I TGATCA 1 cut(s) 154
Kzo9I GATC 1 cut(s) 154
LmnI GCTCC 2 cut(s) 4, 194
LpnPI CCDG 5 cut(s) 42, 165, 171, 189, 216
MaeIII GTNAC 1 cut(s) 46
MalI GATC 1 cut(s) 156
MboI GATC 1 cut(s) 154
MlyI GAGTC 1 cut(s) 88
MnlI CCTC 2 cut(s) 221, 256
MseI TTAA 2 cut(s) 107, 268
MspCI CTTAAG 1 cut(s) 106
MspR9I CCNGG 1 cut(s) 204
MvaI CCWGG 1 cut(s) 204
MwoI GCNNNNNNNGC 2 cut(s) 117, 176
NdeII GATC 1 cut(s) 154
NlaIII CATG 1 cut(s) 236
NlaIV GGNNCC 2 cut(s) 190, 214
NspV TTCGAA 1 cut(s) 36
PfeI GAWTC 1 cut(s) 55
PflFI GACNNNGTC 1 cut(s) 234
PleI GAGTC 1 cut(s) 87
PpsI GAGTC 1 cut(s) 87
Psp6I CCWGG 1 cut(s) 202
PspGI CCWGG 1 cut(s) 202
PspN4I GGNNCC 2 cut(s) 190, 214
PspPI GGNCC 1 cut(s) 26
PsyI GACNNNGTC 1 cut(s) 234
RsaI GTAC 1 cut(s) 241
RsaNI GTAC 1 cut(s) 240
SaqAI TTAA 2 cut(s) 107, 268
Sau3AI GATC 1 cut(s) 154
Sau96I GGNCC 1 cut(s) 26
SchI GAGTC 1 cut(s) 88
ScrFI CCNGG 1 cut(s) 204
SetI ASST 2 cut(s) 9, 172
SfcI CTRYAG 1 cut(s) 133
SfuI TTCGAA 1 cut(s) 36
SinI GGWCC 1 cut(s) 26
SmlI CTYRAG 1 cut(s) 106
SmoI CTYRAG 1 cut(s) 106
StyD4I CCNGG 1 cut(s) 202
TaqI TCGA 2 cut(s) 36, 53
TfiI GAWTC 1 cut(s) 55
Tru1I TTAA 2 cut(s) 107, 268
Tru9I TTAA 2 cut(s) 107, 268
TspGWI ACGGA 1 cut(s) 242
Tth111I GACNNNGTC 1 cut(s) 234
Vha464I CTTAAG 1 cut(s) 106
VpaK11BI GGWCC 1 cut(s) 26
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.