pycom07g13860

Acyclic terpene utilisation family protein AtuA

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr7
OG0002235
Physical Location & Seq
Reverse (-)
15773477 .. 15773919
443 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom07g13860.1

Sequence Viewer

Length: 402 bp
ATGGCACATGCTAATGAAGTCAATTCTTCTACAAATTTGGATAACCGATTTTCTGGAAGTGCAAAATCTCATGCTCCATCTGGTCGGAAGATTCCACTCTATGGTGTAGCACATATCCTGGCTGGAGACAAAGGAAATGACTTGAATTTTTCCATCATCCCTCATTTTCCTCCAGATCAAGTAGTCTCGGCCCTCCTAAACTCCTCCTTGTTCCTGGATATGGATGCCATCAACGAAAGAGACAAATGGGTCCACAAAAATGTAAAGGTCGCAATTTATGAAGTTAGGGGAATCCGATCATTAAACGTTGTGGTTCGGGACATTCTTGACGGTGGTGTAAACTGCTCGAGAAGGATTGACTGGCACGGAAAAACCATCTCAGATCTCATACCCTGCCAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
AtuA

Protein Analysis

134

Amino Acids

14.66

Weight (kDa)

7.86

Isoelectric Point (pI)

23.25

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
AtuA_ferredoxin PF23544 31 - 132 1.8e-30 AtuA ferredoxin-like domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 248
AccB7I CCANNNNNTGG 1 cut(s) 101
AclI AACGTT 1 cut(s) 306
AcsI RAATTY 2 cut(s) 34, 145
AfiI CCNNNNNNNGG 2 cut(s) 101, 220
AgsI TTSAA 1 cut(s) 145
AjnI CCWGG 2 cut(s) 117, 213
Alw26I GTCTC 3 cut(s) 120, 190, 234
Ama87I CYCGRG 1 cut(s) 346
AoxI GGCC 1 cut(s) 189
ApoI RAATTY 2 cut(s) 34, 145
AspS9I GGNCC 2 cut(s) 190, 250
AvaI CYCGRG 1 cut(s) 346
AvaII GGWCC 1 cut(s) 250
BccI CCATC 4 cut(s) 85, 161, 236, 383
BciT130I CCWGG 2 cut(s) 119, 215
BcoDI GTCTC 3 cut(s) 120, 190, 234
BglII AGATCT 1 cut(s) 382
Bme1390I CCNGG 2 cut(s) 119, 215
Bme18I GGWCC 1 cut(s) 250
BmeT110I CYCGRG 1 cut(s) 346
BmgT120I GGNCC 2 cut(s) 190, 250
BmiI GGNNCC 1 cut(s) 251
BmrFI CCNGG 2 cut(s) 119, 215
BmsI GCATC 1 cut(s) 214
BpmI CTGGAG 2 cut(s) 144, 156
Bsc4I CCNNNNNNNGG 2 cut(s) 101, 220
Bse1I ACTGG 2 cut(s) 365, 397
BseBI CCWGG 2 cut(s) 119, 215
BseGI GGATG 2 cut(s) 156, 229
BseLI CCNNNNNNNGG 2 cut(s) 101, 220
BseMII CTCAG 1 cut(s) 393
BseNI ACTGG 2 cut(s) 365, 397
BseRI GAGGAG 1 cut(s) 193
BshFI GGCC 1 cut(s) 191
BsiHKCI CYCGRG 1 cut(s) 346
BslFI GGGAC 1 cut(s) 332
BslI CCNNNNNNNGG 2 cut(s) 101, 220
BsmAI GTCTC 3 cut(s) 120, 190, 234
BsmFI GGGAC 1 cut(s) 332
BsnI GGCC 1 cut(s) 191
BsoBI CYCGRG 1 cut(s) 346
Bsp143I GATC 3 cut(s) 175, 296, 382
BspANI GGCC 1 cut(s) 191
BspCNI CTCAG 1 cut(s) 392
BspLI GGNNCC 1 cut(s) 251
BsrI ACTGG 2 cut(s) 365, 397
BssMI GATC 3 cut(s) 175, 296, 382
Bst2UI CCWGG 2 cut(s) 119, 215
Bst4CI ACNGT 1 cut(s) 332
BstDEI CTNAG 1 cut(s) 379
BstF5I GGATG 2 cut(s) 156, 229
BstKTI GATC 3 cut(s) 178, 299, 385
BstMAI GTCTC 3 cut(s) 120, 190, 234
BstMBI GATC 3 cut(s) 175, 296, 382
BstNI CCWGG 2 cut(s) 119, 215
BstNSI RCATGY 1 cut(s) 11
BstSCI CCNGG 2 cut(s) 117, 213
BstX2I RGATCY 1 cut(s) 382
BstYI RGATCY 1 cut(s) 382
BsuRI GGCC 1 cut(s) 191
BtsCI GGATG 2 cut(s) 156, 229
Cfr13I GGNCC 2 cut(s) 190, 250
CviAII CATG 2 cut(s) 8, 71
CviJI RGCY 2 cut(s) 122, 191
CviKI_1 RGCY 2 cut(s) 122, 191
DdeI CTNAG 1 cut(s) 379
DpnI GATC 3 cut(s) 177, 298, 384
DpnII GATC 3 cut(s) 175, 296, 382
DrdI GACNNNNNNGTC 1 cut(s) 248
DseDI GACNNNNNNGTC 1 cut(s) 248
Eco47I GGWCC 1 cut(s) 250
Eco88I CYCGRG 1 cut(s) 346
EcoRII CCWGG 2 cut(s) 117, 213
FaeI CATG 2 cut(s) 11, 74
FaiI YATR 7 cut(s) 9, 72, 102, 114, 221, 279, 389
FaqI GGGAC 1 cut(s) 332
FatI CATG 2 cut(s) 7, 70
FokI GGATG 2 cut(s) 143, 236
GsuI CTGGAG 2 cut(s) 144, 156
HaeIII GGCC 1 cut(s) 191
Hin1II CATG 2 cut(s) 11, 74
HinfI GANTC 2 cut(s) 91, 291
Hpy166II GTNNAC 2 cut(s) 253, 340
Hpy188I TCNGA 3 cut(s) 87, 296, 382
Hpy188III TCNNGA 5 cut(s) 54, 173, 317, 326, 348
Hpy8I GTNNAC 2 cut(s) 253, 340
HpyAV CCTTC 1 cut(s) 345
HpyCH4III ACNGT 1 cut(s) 332
HpyCH4IV ACGT 1 cut(s) 306
HpyCH4V TGCA 1 cut(s) 62
HpyF3I CTNAG 1 cut(s) 379
HpySE526I ACGT 1 cut(s) 306
Hsp92II CATG 2 cut(s) 11, 74
Kzo9I GATC 3 cut(s) 175, 296, 382
LmnI GCTCC 1 cut(s) 79
LpnPI CCDG 9 cut(s) 39, 66, 104, 108, 131, 186, 200, 227, 346
LweI GCATC 1 cut(s) 214
MaeII ACGT 1 cut(s) 306
MalI GATC 3 cut(s) 177, 298, 384
MboI GATC 3 cut(s) 175, 296, 382
MboII GAAGA 2 cut(s) 18, 100
MflI RGATCY 1 cut(s) 382
MluCI AATT 4 cut(s) 22, 34, 145, 273
MmeI TCCRAC 1 cut(s) 65
MnlI CCTC 4 cut(s) 171, 180, 203, 214
MseI TTAA 1 cut(s) 302
MslI CAYNNNNRTG 2 cut(s) 12, 258
MspR9I CCNGG 2 cut(s) 119, 215
MvaI CCWGG 2 cut(s) 119, 215
NdeII GATC 3 cut(s) 175, 296, 382
NlaIII CATG 2 cut(s) 11, 74
NlaIV GGNNCC 1 cut(s) 251
NmeAIII GCCGAG 1 cut(s) 167
NspI RCATGY 1 cut(s) 11
PaeR7I CTCGAG 1 cut(s) 346
PfeI GAWTC 2 cut(s) 91, 291
PflMI CCANNNNNTGG 1 cut(s) 101
PfoI TCCNGGA 1 cut(s) 213
Psp1406I AACGTT 1 cut(s) 306
Psp6I CCWGG 2 cut(s) 117, 213
PspGI CCWGG 2 cut(s) 117, 213
PspN4I GGNNCC 1 cut(s) 251
PspPI GGNCC 2 cut(s) 190, 250
PsuI RGATCY 1 cut(s) 382
RseI CAYNNNNRTG 2 cut(s) 12, 258
SaqAI TTAA 1 cut(s) 302
Sau3AI GATC 3 cut(s) 175, 296, 382
Sau96I GGNCC 2 cut(s) 190, 250
ScrFI CCNGG 2 cut(s) 119, 215
SetI ASST 2 cut(s) 270, 309
SfaNI GCATC 1 cut(s) 214
Sfr274I CTCGAG 1 cut(s) 346
SinI GGWCC 1 cut(s) 250
SlaI CTCGAG 1 cut(s) 346
SmiMI CAYNNNNRTG 2 cut(s) 12, 258
SmlI CTYRAG 1 cut(s) 346
SmoI CTYRAG 1 cut(s) 346
Sse9I AATT 4 cut(s) 22, 34, 145, 273
StyD4I CCNGG 2 cut(s) 117, 213
TaaI ACNGT 1 cut(s) 332
TaiI ACGT 1 cut(s) 309
TaqI TCGA 1 cut(s) 347
TasI AATT 4 cut(s) 22, 34, 145, 273
TfiI GAWTC 2 cut(s) 91, 291
Tru1I TTAA 1 cut(s) 302
Tru9I TTAA 1 cut(s) 302
TspDTI ATGAA 2 cut(s) 30, 294
TspGWI ACGGA 1 cut(s) 381
Van91I CCANNNNNTGG 1 cut(s) 101
VpaK11BI GGWCC 1 cut(s) 250
XapI RAATTY 2 cut(s) 34, 145
XceI RCATGY 1 cut(s) 11
XhoI CTCGAG 1 cut(s) 346
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.