Rmu_sc0031810.1_g000001

Acyclic terpene utilisation family protein AtuA

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0031810.1
Physical Location & Seq
Forward (+)
1 .. 2249
2249 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0031810.1_g000001.1.cds

Sequence Viewer

Length: 744 bp
atttatgaacttggttggaactgggacaacttggagcagctagcacaggggtctctggcaggccatcttctagagtgtggttgtcaactcacggggggatacttcatgcacccaggggacaagtctcgagacatgtcttcctctcagctcctagacttgtcacttccttatgctgaaattagctctgatggaaaagtatgtgtagcgaaggcagagggtagtggtggggttttgaacttcagtacatgtgctcaacaacttctttatgagatcggaaatccgggtgcttatgtaactcctgatgtgataattgatatccgggatgtttcattctacccattatcaagttgtaaggtcctctgtgctggagcaaaaccatctgcagtatcaattcctgataaactcctgcggttggttccaaaggactatggttggaaaggatggggtgaaatatcttatggaggatatgaatgtgttaaacgtgccaagattgctgaatatctggtgagatcatggatggaagaagtaattcctgatgttagcagccatgtagtttcttatatagttgggcttgatagcctgaagtcaactggtcttagtgacagtgcttcatgtcatatggttagcgatattaggttacgcatggatgggttattcaagctaaaggagcatgcagtccaatttattacagattttactgctttatatacaaatggaccagctggtggtggtggtatcaggtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

247

Amino Acids

26.78

Weight (kDa)

5.22

Isoelectric Point (pI)

33.6

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 725
AciI CCGC 1 cut(s) 409
AcuI CTGAAG 2 cut(s) 223, 602
AfaI GTAC 1 cut(s) 244
AfiI CCNNNNNNNGG 2 cut(s) 412, 725
AflIII ACRYGT 2 cut(s) 132, 245
AgsI TTSAA 2 cut(s) 235, 658
AjnI CCWGG 1 cut(s) 112
AluBI AGCT 5 cut(s) 40, 148, 183, 661, 722
AluI AGCT 5 cut(s) 40, 148, 183, 661, 722
Alw21I GWGCWC 1 cut(s) 253
Alw26I GTCTC 3 cut(s) 57, 123, 129
Ama87I CYCGRG 1 cut(s) 126
AoxI GGCC 1 cut(s) 61
ApeKI GCWGC 2 cut(s) 37, 543
Asp700I GAANNNNTTC 1 cut(s) 528
AspS9I GGNCC 2 cut(s) 355, 716
AsuC2I CCSGG 2 cut(s) 282, 320
AsuHPI GGTGA 2 cut(s) 458, 517
AsuNHI GCTAGC 1 cut(s) 40
AvaI CYCGRG 1 cut(s) 126
AvaII GGWCC 2 cut(s) 355, 716
BbsI GAAGAC 1 cut(s) 129
Bbv12I GWGCWC 1 cut(s) 253
BbvI GCAGC 2 cut(s) 49, 555
BccI CCATC 6 cut(s) 72, 182, 385, 435, 511, 641
BciT130I CCWGG 1 cut(s) 114
BciVI GTATCC 1 cut(s) 92
BcnI CCSGG 2 cut(s) 282, 320
BcoDI GTCTC 3 cut(s) 57, 123, 129
BfaI CTAG 3 cut(s) 41, 71, 152
BfmI CTRYAG 1 cut(s) 381
BfuI GTATCC 1 cut(s) 92
BisI GCNGC 2 cut(s) 38, 544
BlsI GCNGC 2 cut(s) 39, 545
Bme1390I CCNGG 3 cut(s) 114, 282, 320
Bme18I GGWCC 2 cut(s) 355, 716
BmeT110I CYCGRG 1 cut(s) 126
BmgT120I GGNCC 2 cut(s) 355, 716
BmiI GGNNCC 1 cut(s) 417
BmrFI CCNGG 3 cut(s) 114, 282, 320
BmrI ACTGGG 1 cut(s) 31
BmtI GCTAGC 1 cut(s) 44
BmuI ACTGGG 1 cut(s) 31
BpiI GAAGAC 1 cut(s) 129
BpmI CTGGAG 1 cut(s) 387
BpuMI CCSGG 2 cut(s) 282, 320
BsaI GGTCTC 1 cut(s) 57
BsaJI CCNNGG 2 cut(s) 112, 113
Bsc4I CCNNNNNNNGG 2 cut(s) 412, 725
Bse1I ACTGG 2 cut(s) 26, 595
BseBI CCWGG 1 cut(s) 114
BseDI CCNNGG 2 cut(s) 112, 113
BseGI GGATG 4 cut(s) 328, 446, 522, 652
BseLI CCNNNNNNNGG 2 cut(s) 412, 725
BseMII CTCAG 1 cut(s) 158
BseNI ACTGG 2 cut(s) 26, 595
BseXI GCAGC 2 cut(s) 49, 555
BshFI GGCC 1 cut(s) 63
BsiHKAI GWGCWC 1 cut(s) 253
BsiHKCI CYCGRG 1 cut(s) 126
BsiSI CCGG 2 cut(s) 281, 319
BslFI GGGAC 2 cut(s) 38, 131
BslI CCNNNNNNNGG 2 cut(s) 412, 725
BsmAI GTCTC 3 cut(s) 57, 123, 129
BsmFI GGGAC 2 cut(s) 38, 131
BsnI GGCC 1 cut(s) 63
Bso31I GGTCTC 1 cut(s) 57
BsoBI CYCGRG 1 cut(s) 126
Bsp1286I GDGCHC 1 cut(s) 253
Bsp143I GATC 2 cut(s) 270, 509
BspACI CCGC 1 cut(s) 409
BspANI GGCC 1 cut(s) 63
BspCNI CTCAG 1 cut(s) 157
BspLI GGNNCC 1 cut(s) 417
BspMAI CTGCAG 1 cut(s) 385
BspOI GCTAGC 1 cut(s) 44
BspTNI GGTCTC 1 cut(s) 57
BsrI ACTGG 2 cut(s) 26, 595
BssECI CCNNGG 2 cut(s) 112, 113
BssMI GATC 2 cut(s) 270, 509
Bst2UI CCWGG 1 cut(s) 114
Bst4CI ACNGT 1 cut(s) 605
BstC8I GCNNGC 3 cut(s) 42, 61, 672
BstDEI CTNAG 2 cut(s) 144, 596
BstF5I GGATG 4 cut(s) 328, 446, 522, 652
BstKTI GATC 2 cut(s) 273, 512
BstMAI GTCTC 3 cut(s) 57, 123, 129
BstMBI GATC 2 cut(s) 270, 509
BstMWI GCNNNNNNNGC 2 cut(s) 491, 667
BstNI CCWGG 1 cut(s) 114
BstNSI RCATGY 3 cut(s) 136, 249, 674
BstSCI CCNGG 3 cut(s) 112, 280, 318
BstSFI CTRYAG 1 cut(s) 381
BstV1I GCAGC 2 cut(s) 49, 555
BstV2I GAAGAC 1 cut(s) 129
BsuI GTATCC 1 cut(s) 92
BsuRI GGCC 1 cut(s) 63
BtsCI GGATG 4 cut(s) 328, 446, 522, 652
BtsIMutI CAGTG 1 cut(s) 610
Cac8I GCNNGC 3 cut(s) 42, 61, 672
Cfr13I GGNCC 2 cut(s) 355, 716
Csp6I GTAC 1 cut(s) 243
CviAII CATG 8 cut(s) 106, 133, 246, 513, 548, 612, 643, 671
CviJI RGCY 9 cut(s) 40, 63, 148, 183, 546, 571, 579, 661, 722
CviKI_1 RGCY 9 cut(s) 40, 63, 148, 183, 546, 571, 579, 661, 722
CviQI GTAC 1 cut(s) 243
DdeI CTNAG 2 cut(s) 144, 596
DpnI GATC 2 cut(s) 272, 511
DpnII GATC 2 cut(s) 270, 509
Eco31I GGTCTC 1 cut(s) 57
Eco32I GATATC 1 cut(s) 316
Eco47I GGWCC 2 cut(s) 355, 716
Eco57I CTGAAG 2 cut(s) 223, 602
Eco88I CYCGRG 1 cut(s) 126
EcoO109I RGGNCCY 1 cut(s) 355
EcoRII CCWGG 1 cut(s) 112
EcoRV GATATC 1 cut(s) 316
FaeI CATG 8 cut(s) 109, 136, 249, 516, 551, 615, 646, 674
FaqI GGGAC 2 cut(s) 38, 131
FatI CATG 8 cut(s) 105, 132, 245, 512, 547, 611, 642, 670
FauNDI CATATG 1 cut(s) 618
Fnu4HI GCNGC 2 cut(s) 38, 544
FokI GGATG 4 cut(s) 335, 453, 529, 659
Fsp4HI GCNGC 2 cut(s) 38, 544
FspBI CTAG 3 cut(s) 41, 71, 152
GluI GCNGC 2 cut(s) 38, 544
GsuI CTGGAG 1 cut(s) 387
HaeIII GGCC 1 cut(s) 63
HapII CCGG 2 cut(s) 281, 319
Hin1II CATG 8 cut(s) 109, 136, 249, 516, 551, 615, 646, 674
HincII GTYRAC 2 cut(s) 86, 588
HindII GTYRAC 2 cut(s) 86, 588
HpaII CCGG 2 cut(s) 281, 319
HphI GGTGA 2 cut(s) 458, 517
Hpy166II GTNNAC 2 cut(s) 86, 588
Hpy188I TCNGA 2 cut(s) 187, 275
Hpy188III TCNNGA 6 cut(s) 71, 126, 128, 299, 395, 533
Hpy8I GTNNAC 2 cut(s) 86, 588
HpyAV CCTTC 1 cut(s) 202
HpyCH4III ACNGT 1 cut(s) 605
HpyCH4IV ACGT 1 cut(s) 481
HpyCH4V TGCA 3 cut(s) 109, 383, 674
HpyF10VI GCNNNNNNNGC 2 cut(s) 491, 667
HpyF3I CTNAG 2 cut(s) 144, 596
HpySE526I ACGT 1 cut(s) 481
Hsp92II CATG 8 cut(s) 109, 136, 249, 516, 551, 615, 646, 674
Kzo9I GATC 2 cut(s) 270, 509
LmnI GCTCC 4 cut(s) 34, 153, 368, 667
Lsp1109I GCAGC 2 cut(s) 49, 555
MaeI CTAG 3 cut(s) 41, 71, 152
MaeII ACGT 1 cut(s) 481
MaeIII GTNAC 4 cut(s) 159, 292, 599, 636
MalI GATC 2 cut(s) 272, 511
MboI GATC 2 cut(s) 270, 509
MboII GAAGA 3 cut(s) 59, 129, 533
MhlI GDGCHC 1 cut(s) 253
MluCI AATT 5 cut(s) 177, 309, 390, 528, 680
MmeI TCCRAC 1 cut(s) 413
MnlI CCTC 4 cut(s) 151, 208, 368, 455
MroXI GAANNNNTTC 1 cut(s) 528
MseI TTAA 1 cut(s) 477
MspA1I CMGCKG 1 cut(s) 722
MspI CCGG 2 cut(s) 281, 319
MspR9I CCNGG 3 cut(s) 114, 282, 320
MvaI CCWGG 1 cut(s) 114
MwoI GCNNNNNNNGC 2 cut(s) 491, 667
NciI CCSGG 2 cut(s) 282, 320
NdeI CATATG 1 cut(s) 618
NdeII GATC 2 cut(s) 270, 509
NheI GCTAGC 1 cut(s) 40
NlaIII CATG 8 cut(s) 109, 136, 249, 516, 551, 615, 646, 674
NlaIV GGNNCC 1 cut(s) 417
NmuCI GTSAC 2 cut(s) 159, 599
NspI RCATGY 3 cut(s) 136, 249, 674
PaeI GCATGC 1 cut(s) 674
PaeR7I CTCGAG 1 cut(s) 126
PasI CCCWGGG 1 cut(s) 113
PciI ACATGT 2 cut(s) 132, 245
PdmI GAANNNNTTC 1 cut(s) 528
PflMI CCANNNNNTGG 1 cut(s) 725
PfoI TCCNGGA 1 cut(s) 318
PkrI GCNGC 2 cut(s) 39, 545
PpuMI RGGWCCY 1 cut(s) 355
PscI ACATGT 2 cut(s) 132, 245
Psp5II RGGWCCY 1 cut(s) 355
Psp6I CCWGG 1 cut(s) 112
PspGI CCWGG 1 cut(s) 112
PspN4I GGNNCC 1 cut(s) 417
PspPI GGNCC 2 cut(s) 355, 716
PspPPI RGGWCCY 1 cut(s) 355
PstI CTGCAG 1 cut(s) 385
PvuII CAGCTG 1 cut(s) 722
RsaI GTAC 1 cut(s) 244
RsaNI GTAC 1 cut(s) 243
SaqAI TTAA 1 cut(s) 477
SatI GCNGC 2 cut(s) 38, 544
Sau3AI GATC 2 cut(s) 270, 509
Sau96I GGNCC 2 cut(s) 355, 716
ScrFI CCNGG 3 cut(s) 114, 282, 320
SduI GDGCHC 1 cut(s) 253
SetI ASST 9 cut(s) 42, 150, 185, 357, 484, 638, 663, 724, 743
SfcI CTRYAG 1 cut(s) 381
Sfr274I CTCGAG 1 cut(s) 126
SinI GGWCC 2 cut(s) 355, 716
SlaI CTCGAG 1 cut(s) 126
SmlI CTYRAG 1 cut(s) 126
SmoI CTYRAG 1 cut(s) 126
SphI GCATGC 1 cut(s) 674
Sse9I AATT 5 cut(s) 177, 309, 390, 528, 680
SsiI CCGC 1 cut(s) 409
SspMI CTAG 3 cut(s) 41, 71, 152
StyD4I CCNGG 3 cut(s) 112, 280, 318
TaaI ACNGT 1 cut(s) 605
TaiI ACGT 1 cut(s) 484
TaqI TCGA 1 cut(s) 127
TasI AATT 5 cut(s) 177, 309, 390, 528, 680
TatI WGTACW 1 cut(s) 242
Tru1I TTAA 1 cut(s) 477
Tru9I TTAA 1 cut(s) 477
TscAI CASTG 1 cut(s) 610
TseFI GTSAC 2 cut(s) 159, 599
TseI GCWGC 2 cut(s) 37, 543
Tsp45I GTSAC 2 cut(s) 159, 599
TspDTI ATGAA 5 cut(s) 21, 94, 318, 483, 600
TspRI CASTG 1 cut(s) 610
Van91I CCANNNNNTGG 1 cut(s) 725
VpaK11BI GGWCC 2 cut(s) 355, 716
XbaI TCTAGA 1 cut(s) 70
XceI RCATGY 3 cut(s) 136, 249, 674
XhoI CTCGAG 1 cut(s) 126
XmnI GAANNNNTTC 1 cut(s) 528
XspI CTAG 3 cut(s) 41, 71, 152
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.