Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0004632.1

Orthogroup ID

OG0002235

Physical Location & Seq

Genomic Coordinates Forward (+)

11210 .. 12834

Gene Structure 1625 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0004632.1_g000002.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 564 bp

atgtcttcctctcagctcctagacttttcacttccttatgctgaaattagctctgatgaaaaagtatatgtagcgaaggcagagggtagtggtggggttttgaacttcagtacatgtgctcaacaacttctttatgagatcgggaatccgggtgcttatgtaactcctgatgtgataattgatatcggggatgtttcattctacccattatcaagttgtaaggtcctgtgtgctggagcaaaaccatctgcagtatcagttcctgataaactcttgcggttggttccaaaggtgagatcatggatggaagaagtaattcctgatgttagcagccatgcagtttcttatatagttgggcttgatagcctgaaggcaactggtcttagtgacactgcttcatgtcagatggttagcgatataaggttacgcatggatgggttattcaagctaaaggagcatgcagtccaatttattacaggttttactgctttatatacaaatggaccagctggtggtggtggtatcagaattcttactaaagccaaatcctcaatgaaacagtaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

AtuA

Protein Analysis

187

Amino Acids

19.92

Weight (kDa)

6.1

Isoelectric Point (pI)

31.75

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002235)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G01770
fragaria_vesca	FvH4_7g13830 FvH4_7g13830 FvH4_7g13830 FvH4_7g13830 FvH4_7g13830 FvH4_7g13830 FvH4_7g13830 FvH4_7g13830 FvH4_7g13830 FvH4_7g13830 FvH4_7g13830
malus_domestica	MD01G1054400.v1.1 MD10G1234500.v1.1
prunus_persica	Prupe.2G164100_v2.0.a1 Prupe.2G164100_v2.0.a1 Prupe.2G164100_v2.0.a1 Prupe.2G164100_v2.0.a1
pyrus_communis	pycom01g07960 pycom06g04950 pycom07g13860 pycom07g13870
rosa_chinensis	RchiOBHm_Chr1g0354021 RchiOBHm_Chr1g0354041
rosa_laevigata	RLG00000028232 RLG00000028235
rosa_multiflora	Rmu_sc0004632.1_g000002 Rmu_sc0004632.1_g000004 Rmu_sc0025756.1_g000001 Rmu_sc0031149.1_g000001 Rmu_sc0031810.1_g000001
rosa_roxburghii	Rroxscaffold_4G00301280 Rroxscaffold_4G00301310 Rroxscaffold_4G00301330
rosa_rugosa	Rorug01G0240300 Rorug01G0240500
rosa_samantha	Rh1AG251600 Rh1BG223200 Rh1BG223400 Rh1CG236000 Rh1DG250100 Rh1DG250300
rosa_wichuraiana	Rw1G021940

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	512
AciI	CCGC	1 cut(s)	277
AcsI	RAATTY	1 cut(s)	528
AcuI	CTGAAG	2 cut(s)	91, 389
AfaI	GTAC	1 cut(s)	112
AfiI	CCNNNNNNNGG	1 cut(s)	512
AflIII	ACRYGT	1 cut(s)	113
AgsI	TTSAA	2 cut(s)	103, 445
AluBI	AGCT	4 cut(s)	16, 51, 448, 509
AluI	AGCT	4 cut(s)	16, 51, 448, 509
Alw21I	GWGCWC	1 cut(s)	121
AlwNI	CAGNNNCTG	1 cut(s)	263
ApeKI	GCWGC	1 cut(s)	330
ApoI	RAATTY	1 cut(s)	528
Asp700I	GAANNNNTTC	1 cut(s)	315
AspS9I	GGNCC	2 cut(s)	223, 503
AsuC2I	CCSGG	1 cut(s)	150
AsuHPI	GGTGA	1 cut(s)	304
AvaII	GGWCC	2 cut(s)	223, 503
Bbv12I	GWGCWC	1 cut(s)	121
BbvI	GCAGC	1 cut(s)	342
BccI	CCATC	4 cut(s)	253, 298, 400, 428
BcnI	CCSGG	1 cut(s)	150
BfaI	CTAG	1 cut(s)	20
BfmI	CTRYAG	1 cut(s)	249
BisI	GCNGC	1 cut(s)	331
BlsI	GCNGC	1 cut(s)	332
Bme1390I	CCNGG	1 cut(s)	150
Bme18I	GGWCC	2 cut(s)	223, 503
BmgT120I	GGNCC	2 cut(s)	223, 503
BmiI	GGNNCC	1 cut(s)	285
BmrFI	CCNGG	1 cut(s)	150
BpmI	CTGGAG	1 cut(s)	255
BpuMI	CCSGG	1 cut(s)	150
Bsc4I	CCNNNNNNNGG	1 cut(s)	512
Bse1I	ACTGG	1 cut(s)	382
BseGI	GGATG	3 cut(s)	196, 309, 439
BseLI	CCNNNNNNNGG	1 cut(s)	512
BseMII	CTCAG	1 cut(s)	26
BseNI	ACTGG	1 cut(s)	382
BseXI	GCAGC	1 cut(s)	342
BsiHKAI	GWGCWC	1 cut(s)	121
BsiSI	CCGG	1 cut(s)	149
BslI	CCNNNNNNNGG	1 cut(s)	512
Bsp1286I	GDGCHC	1 cut(s)	121
Bsp143I	GATC	2 cut(s)	138, 296
BspACI	CCGC	1 cut(s)	277
BspCNI	CTCAG	1 cut(s)	25
BspLI	GGNNCC	1 cut(s)	285
BspMAI	CTGCAG	1 cut(s)	253
BsrI	ACTGG	1 cut(s)	382
BssMI	GATC	2 cut(s)	138, 296
Bst4CI	ACNGT	1 cut(s)	561
BstC8I	GCNNGC	1 cut(s)	459
BstDEI	CTNAG	2 cut(s)	12, 383
BstF5I	GGATG	3 cut(s)	196, 309, 439
BstKTI	GATC	2 cut(s)	141, 299
BstMBI	GATC	2 cut(s)	138, 296
BstMWI	GCNNNNNNNGC	1 cut(s)	454
BstNSI	RCATGY	2 cut(s)	117, 461
BstSCI	CCNGG	1 cut(s)	148
BstSFI	CTRYAG	1 cut(s)	249
BstV1I	GCAGC	1 cut(s)	342
BtsCI	GGATG	3 cut(s)	196, 309, 439
BtsI	GCAGTG	1 cut(s)	390
BtsIMutI	CAGTG	1 cut(s)	390
Cac8I	GCNNGC	1 cut(s)	459
CaiI	CAGNNNCTG	1 cut(s)	263
Cfr13I	GGNCC	2 cut(s)	223, 503
Csp6I	GTAC	1 cut(s)	111
CviAII	CATG	6 cut(s)	114, 300, 335, 399, 430, 458
CviJI	RGCY	8 cut(s)	16, 51, 333, 358, 366, 448, 509, 542
CviKI_1	RGCY	8 cut(s)	16, 51, 333, 358, 366, 448, 509, 542
CviQI	GTAC	1 cut(s)	111
DdeI	CTNAG	2 cut(s)	12, 383
DpnI	GATC	2 cut(s)	140, 298
DpnII	GATC	2 cut(s)	138, 296
Eco32I	GATATC	1 cut(s)	184
Eco47I	GGWCC	2 cut(s)	223, 503
Eco57I	CTGAAG	2 cut(s)	91, 389
EcoO109I	RGGNCCY	1 cut(s)	223
EcoRI	GAATTC	1 cut(s)	528
EcoRV	GATATC	1 cut(s)	184
FaeI	CATG	6 cut(s)	117, 303, 338, 402, 433, 461
FatI	CATG	6 cut(s)	113, 299, 334, 398, 429, 457
Fnu4HI	GCNGC	1 cut(s)	331
FokI	GGATG	3 cut(s)	203, 316, 446
Fsp4HI	GCNGC	1 cut(s)	331
FspBI	CTAG	1 cut(s)	20
GluI	GCNGC	1 cut(s)	331
GsuI	CTGGAG	1 cut(s)	255
HapII	CCGG	1 cut(s)	149
Hin1II	CATG	6 cut(s)	117, 303, 338, 402, 433, 461
HinfI	GANTC	1 cut(s)	145
HpaII	CCGG	1 cut(s)	149
HphI	GGTGA	1 cut(s)	304
Hpy188I	TCNGA	3 cut(s)	55, 405, 527
Hpy188III	TCNNGA	4 cut(s)	142, 167, 263, 320
HpyAV	CCTTC	2 cut(s)	70, 364
HpyCH4III	ACNGT	1 cut(s)	561
HpyCH4V	TGCA	3 cut(s)	251, 338, 461
HpyF10VI	GCNNNNNNNGC	1 cut(s)	454
HpyF3I	CTNAG	2 cut(s)	12, 383
Hsp92II	CATG	6 cut(s)	117, 303, 338, 402, 433, 461
Kzo9I	GATC	2 cut(s)	138, 296
LmnI	GCTCC	3 cut(s)	21, 236, 454
Lsp1109I	GCAGC	1 cut(s)	342
MaeI	CTAG	1 cut(s)	20
MaeIII	GTNAC	3 cut(s)	160, 386, 423
MalI	GATC	2 cut(s)	140, 298
MboI	GATC	2 cut(s)	138, 296
MboII	GAAGA	1 cut(s)	320
MhlI	GDGCHC	1 cut(s)	121
MluCI	AATT	5 cut(s)	45, 177, 315, 467, 528
MnlI	CCTC	3 cut(s)	19, 76, 559
MroXI	GAANNNNTTC	1 cut(s)	315
MspA1I	CMGCKG	1 cut(s)	509
MspI	CCGG	1 cut(s)	149
MspR9I	CCNGG	1 cut(s)	150
MwoI	GCNNNNNNNGC	1 cut(s)	454
NciI	CCSGG	1 cut(s)	150
NdeII	GATC	2 cut(s)	138, 296
NlaIII	CATG	6 cut(s)	117, 303, 338, 402, 433, 461
NlaIV	GGNNCC	1 cut(s)	285
NmuCI	GTSAC	1 cut(s)	386
NspI	RCATGY	2 cut(s)	117, 461
PaeI	GCATGC	1 cut(s)	461
PciI	ACATGT	1 cut(s)	113
PdmI	GAANNNNTTC	1 cut(s)	315
PfeI	GAWTC	1 cut(s)	145
PflMI	CCANNNNNTGG	1 cut(s)	512
PkrI	GCNGC	1 cut(s)	332
PpuMI	RGGWCCY	1 cut(s)	223
PscI	ACATGT	1 cut(s)	113
Psp5II	RGGWCCY	1 cut(s)	223
PspN4I	GGNNCC	1 cut(s)	285
PspPI	GGNCC	2 cut(s)	223, 503
PspPPI	RGGWCCY	1 cut(s)	223
PstI	CTGCAG	1 cut(s)	253
PstNI	CAGNNNCTG	1 cut(s)	263
PvuII	CAGCTG	1 cut(s)	509
RsaI	GTAC	1 cut(s)	112
RsaNI	GTAC	1 cut(s)	111
SatI	GCNGC	1 cut(s)	331
Sau3AI	GATC	2 cut(s)	138, 296
Sau96I	GGNCC	2 cut(s)	223, 503
ScrFI	CCNGG	1 cut(s)	150
SduI	GDGCHC	1 cut(s)	121
SetI	ASST	8 cut(s)	18, 53, 225, 294, 425, 450, 481, 511
SfcI	CTRYAG	1 cut(s)	249
SinI	GGWCC	2 cut(s)	223, 503
SphI	GCATGC	1 cut(s)	461
Sse9I	AATT	5 cut(s)	45, 177, 315, 467, 528
SsiI	CCGC	1 cut(s)	277
SspMI	CTAG	1 cut(s)	20
StyD4I	CCNGG	1 cut(s)	148
TaaI	ACNGT	1 cut(s)	561
TasI	AATT	5 cut(s)	45, 177, 315, 467, 528
TatI	WGTACW	1 cut(s)	110
TfiI	GAWTC	1 cut(s)	145
TscAI	CASTG	1 cut(s)	397
TseFI	GTSAC	1 cut(s)	386
TseI	GCWGC	1 cut(s)	330
Tsp45I	GTSAC	1 cut(s)	386
TspDTI	ATGAA	3 cut(s)	72, 186, 387
TspRI	CASTG	1 cut(s)	397
Van91I	CCANNNNNTGG	1 cut(s)	512
VpaK11BI	GGWCC	2 cut(s)	223, 503
XapI	RAATTY	1 cut(s)	528
XceI	RCATGY	2 cut(s)	117, 461
XmnI	GAANNNNTTC	1 cut(s)	315
XspI	CTAG	1 cut(s)	20

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.