Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0025756.1

Orthogroup ID

OG0002235

Physical Location & Seq

Genomic Coordinates Reverse (-)

93 .. 652

Gene Structure 560 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0025756.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 378 bp

atgctttactcttctagttttcaggactatggttggaaaggatggggtgaaatatcttatggaggatttgaatgggttaaacgtgccaagatcgctgaatttctggtgagatcatggatggaagaagtaattcctgatgttagcagccatgcagtttcttatatagttgggcttgatagcctgaaggcaactggtcttagtgacactgcttcatgtcagatggttagcgatattaggttacgcatggatgggttattcaagctaaaggagcatgcagtccaatttattacaggttttactgctttatatacaaatggaccagctggtggtggtggtatcagaattcttattaaagccaaatcctcaatgaaacagtaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

AtuA

Protein Analysis

125

Amino Acids

13.82

Weight (kDa)

8.71

Isoelectric Point (pI)

25.87

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002235)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G01770
fragaria_vesca	FvH4_7g13830 FvH4_7g13830 FvH4_7g13830 FvH4_7g13830 FvH4_7g13830 FvH4_7g13830 FvH4_7g13830 FvH4_7g13830 FvH4_7g13830 FvH4_7g13830 FvH4_7g13830
malus_domestica	MD01G1054400.v1.1 MD10G1234500.v1.1
prunus_persica	Prupe.2G164100_v2.0.a1 Prupe.2G164100_v2.0.a1 Prupe.2G164100_v2.0.a1 Prupe.2G164100_v2.0.a1
pyrus_communis	pycom01g07960 pycom06g04950 pycom07g13860 pycom07g13870
rosa_chinensis	RchiOBHm_Chr1g0354021 RchiOBHm_Chr1g0354041
rosa_laevigata	RLG00000028232 RLG00000028235
rosa_multiflora	Rmu_sc0004632.1_g000002 Rmu_sc0004632.1_g000004 Rmu_sc0025756.1_g000001 Rmu_sc0031149.1_g000001 Rmu_sc0031810.1_g000001
rosa_roxburghii	Rroxscaffold_4G00301280 Rroxscaffold_4G00301310 Rroxscaffold_4G00301330
rosa_rugosa	Rorug01G0240300 Rorug01G0240500
rosa_samantha	Rh1AG251600 Rh1BG223200 Rh1BG223400 Rh1CG236000 Rh1DG250100 Rh1DG250300
rosa_wichuraiana	Rw1G021940

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	326
AcsI	RAATTY	2 cut(s)	98, 342
AcuI	CTGAAG	1 cut(s)	203
AfiI	CCNNNNNNNGG	1 cut(s)	326
AgsI	TTSAA	2 cut(s)	71, 259
AluBI	AGCT	2 cut(s)	262, 323
AluI	AGCT	2 cut(s)	262, 323
ApeKI	GCWGC	1 cut(s)	144
ApoI	RAATTY	2 cut(s)	98, 342
Asp700I	GAANNNNTTC	1 cut(s)	129
AspS9I	GGNCC	1 cut(s)	317
AsuHPI	GGTGA	2 cut(s)	59, 118
AvaII	GGWCC	1 cut(s)	317
BbvI	GCAGC	1 cut(s)	156
BccI	CCATC	4 cut(s)	36, 112, 214, 242
BfaI	CTAG	1 cut(s)	15
BisI	GCNGC	1 cut(s)	145
BlsI	GCNGC	1 cut(s)	146
Bme18I	GGWCC	1 cut(s)	317
BmgT120I	GGNCC	1 cut(s)	317
Bsc4I	CCNNNNNNNGG	1 cut(s)	326
Bse1I	ACTGG	1 cut(s)	196
BseGI	GGATG	3 cut(s)	47, 123, 253
BseLI	CCNNNNNNNGG	1 cut(s)	326
BseNI	ACTGG	1 cut(s)	196
BseXI	GCAGC	1 cut(s)	156
BslI	CCNNNNNNNGG	1 cut(s)	326
Bsp143I	GATC	2 cut(s)	90, 110
BsrI	ACTGG	1 cut(s)	196
BssMI	GATC	2 cut(s)	90, 110
Bst4CI	ACNGT	1 cut(s)	375
Bst6I	CTCTTC	1 cut(s)	16
BstC8I	GCNNGC	1 cut(s)	273
BstDEI	CTNAG	1 cut(s)	197
BstF5I	GGATG	3 cut(s)	47, 123, 253
BstKTI	GATC	2 cut(s)	93, 113
BstMBI	GATC	2 cut(s)	90, 110
BstMWI	GCNNNNNNNGC	2 cut(s)	92, 268
BstNSI	RCATGY	1 cut(s)	275
BstV1I	GCAGC	1 cut(s)	156
BtsCI	GGATG	3 cut(s)	47, 123, 253
BtsI	GCAGTG	1 cut(s)	204
BtsIMutI	CAGTG	1 cut(s)	204
Cac8I	GCNNGC	1 cut(s)	273
Cfr13I	GGNCC	1 cut(s)	317
CviAII	CATG	5 cut(s)	114, 149, 213, 244, 272
CviJI	RGCY	6 cut(s)	147, 172, 180, 262, 323, 356
CviKI_1	RGCY	6 cut(s)	147, 172, 180, 262, 323, 356
DdeI	CTNAG	1 cut(s)	197
DpnI	GATC	2 cut(s)	92, 112
DpnII	GATC	2 cut(s)	90, 110
Eam1104I	CTCTTC	1 cut(s)	16
EarI	CTCTTC	1 cut(s)	16
Eco47I	GGWCC	1 cut(s)	317
Eco57I	CTGAAG	1 cut(s)	203
EcoRI	GAATTC	1 cut(s)	342
FaeI	CATG	5 cut(s)	117, 152, 216, 247, 275
FatI	CATG	5 cut(s)	113, 148, 212, 243, 271
Fnu4HI	GCNGC	1 cut(s)	145
FokI	GGATG	3 cut(s)	54, 130, 260
Fsp4HI	GCNGC	1 cut(s)	145
FspBI	CTAG	1 cut(s)	15
GluI	GCNGC	1 cut(s)	145
Hin1II	CATG	5 cut(s)	117, 152, 216, 247, 275
HphI	GGTGA	2 cut(s)	59, 118
Hpy188I	TCNGA	2 cut(s)	219, 341
Hpy188III	TCNNGA	2 cut(s)	23, 134
HpyAV	CCTTC	1 cut(s)	178
HpyCH4III	ACNGT	1 cut(s)	375
HpyCH4IV	ACGT	1 cut(s)	82
HpyCH4V	TGCA	2 cut(s)	152, 275
HpyF10VI	GCNNNNNNNGC	2 cut(s)	92, 268
HpyF3I	CTNAG	1 cut(s)	197
HpySE526I	ACGT	1 cut(s)	82
Hsp92II	CATG	5 cut(s)	117, 152, 216, 247, 275
Kzo9I	GATC	2 cut(s)	90, 110
LmnI	GCTCC	1 cut(s)	268
LpnPI	CCDG	8 cut(s)	8, 89, 147, 177, 194, 276, 309, 333
Lsp1109I	GCAGC	1 cut(s)	156
MaeI	CTAG	1 cut(s)	15
MaeII	ACGT	1 cut(s)	82
MaeIII	GTNAC	2 cut(s)	200, 237
MalI	GATC	2 cut(s)	92, 112
MboI	GATC	2 cut(s)	90, 110
MboII	GAAGA	2 cut(s)	3, 134
MluCI	AATT	4 cut(s)	98, 129, 281, 342
MmeI	TCCRAC	1 cut(s)	14
MnlI	CCTC	2 cut(s)	56, 373
MroXI	GAANNNNTTC	1 cut(s)	129
MseI	TTAA	2 cut(s)	78, 351
MspA1I	CMGCKG	1 cut(s)	323
MwoI	GCNNNNNNNGC	2 cut(s)	92, 268
NdeII	GATC	2 cut(s)	90, 110
NlaIII	CATG	5 cut(s)	117, 152, 216, 247, 275
NmuCI	GTSAC	1 cut(s)	200
NspI	RCATGY	1 cut(s)	275
PaeI	GCATGC	1 cut(s)	275
PdmI	GAANNNNTTC	1 cut(s)	129
PflMI	CCANNNNNTGG	1 cut(s)	326
PkrI	GCNGC	1 cut(s)	146
PspPI	GGNCC	1 cut(s)	317
PvuII	CAGCTG	1 cut(s)	323
SaqAI	TTAA	2 cut(s)	78, 351
SatI	GCNGC	1 cut(s)	145
Sau3AI	GATC	2 cut(s)	90, 110
Sau96I	GGNCC	1 cut(s)	317
SetI	ASST	5 cut(s)	85, 239, 264, 295, 325
SinI	GGWCC	1 cut(s)	317
SphI	GCATGC	1 cut(s)	275
Sse9I	AATT	4 cut(s)	98, 129, 281, 342
SspMI	CTAG	1 cut(s)	15
TaaI	ACNGT	1 cut(s)	375
TaiI	ACGT	1 cut(s)	85
TasI	AATT	4 cut(s)	98, 129, 281, 342
Tru1I	TTAA	2 cut(s)	78, 351
Tru9I	TTAA	2 cut(s)	78, 351
TscAI	CASTG	1 cut(s)	211
TseFI	GTSAC	1 cut(s)	200
TseI	GCWGC	1 cut(s)	144
Tsp45I	GTSAC	1 cut(s)	200
TspDTI	ATGAA	1 cut(s)	201
TspRI	CASTG	1 cut(s)	211
Van91I	CCANNNNNTGG	1 cut(s)	326
VpaK11BI	GGWCC	1 cut(s)	317
XapI	RAATTY	2 cut(s)	98, 342
XceI	RCATGY	1 cut(s)	275
XmnI	GAANNNNTTC	1 cut(s)	129
XspI	CTAG	1 cut(s)	15

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.