MD11G1124600.v1.1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr11
OG0002295
Physical Location & Seq
Reverse (-)
11443558 .. 11444414
857 bp
Loading structure...
UTR
Exon/CDS
Intron
MD11G1124600.v1.1.491

Sequence Viewer

Length: 486 bp
ATGCCGATGCAACTATCCTTGATGTTCTTAGTGAGTTCCCTAACTTGGCTACAGTCATTTTTGGCTATCAGTCATGTGCAAGTTCAGAGTCCTGGGACTCCACCGGAGAAAGCAGTGGATATTGTTCAAGAGGAAGCTTCTAGGGGAGGTTTGGATATCATGGTCAAAGTGGAGGAGCTTAAACGGATGTTGGCACATGCAAAAGACGCAAATGACATGGTTCATGCTGGAGAAGTCTTTGGGGAGAAAGCAATTTTAGCAACTGAAGCGAAGGAGCTTCAGTCTCGATTGCTCAACTTATCAGATGAGAGAGATAAATCACTTGCGATTCTTAATGAGGTTGACTCCACTTCATTGAGTTGCTTATTGCACTGCATTACTGTTGGTGCATGCTCTATTTCACTAATTTATCCATTTATCTTTAGATTGCCTCATTTTTATGCTGTCTTTTTCGTATCGTATTCTTCAAAAACAACAATTGCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
CUE

Protein Analysis

162

Amino Acids

17.79

Weight (kDa)

5.47

Isoelectric Point (pI)

50.18

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 2 cut(s) 263, 285
AfiI CCNNNNNNNGG 1 cut(s) 45
AgsI TTSAA 2 cut(s) 128, 468
AjnI CCWGG 1 cut(s) 91
AluBI AGCT 3 cut(s) 137, 178, 277
AluI AGCT 3 cut(s) 137, 178, 277
Alw26I GTCTC 1 cut(s) 288
BciT130I CCWGG 1 cut(s) 93
BcoDI GTCTC 1 cut(s) 288
BfaI CTAG 1 cut(s) 141
BfmI CTRYAG 1 cut(s) 50
Bme1390I CCNGG 1 cut(s) 93
BmrFI CCNGG 1 cut(s) 93
BplI GAGNNNNNCTC 2 cut(s) 329, 361
BpmI CTGGAG 1 cut(s) 249
BsaJI CCNNGG 1 cut(s) 92
BsaWI WCCGGW 1 cut(s) 103
BsaXI ACNNNNNCTCC 2 cut(s) 266, 296
Bsc4I CCNNNNNNNGG 1 cut(s) 45
BseBI CCWGG 1 cut(s) 93
BseDI CCNNGG 1 cut(s) 92
BseGI GGATG 1 cut(s) 192
BseLI CCNNNNNNNGG 1 cut(s) 45
BseRI GAGGAG 1 cut(s) 188
BsiSI CCGG 1 cut(s) 104
BslFI GGGAC 1 cut(s) 109
BslI CCNNNNNNNGG 1 cut(s) 45
BsmAI GTCTC 1 cut(s) 288
BsmFI GGGAC 1 cut(s) 109
BssECI CCNNGG 1 cut(s) 92
Bst2UI CCWGG 1 cut(s) 93
Bst4CI ACNGT 2 cut(s) 54, 382
BstC8I GCNNGC 1 cut(s) 391
BstDEI CTNAG 1 cut(s) 28
BstF5I GGATG 1 cut(s) 192
BstMAI GTCTC 1 cut(s) 288
BstMWI GCNNNNNNNGC 3 cut(s) 206, 257, 266
BstNI CCWGG 1 cut(s) 93
BstNSI RCATGY 2 cut(s) 200, 393
BstSCI CCNGG 1 cut(s) 91
BstSFI CTRYAG 1 cut(s) 50
BtsCI GGATG 1 cut(s) 192
BtsI GCAGTG 2 cut(s) 120, 370
BtsIMutI CAGTG 2 cut(s) 120, 370
Cac8I GCNNGC 1 cut(s) 391
CseI GACGC 1 cut(s) 215
CviAII CATG 7 cut(s) 74, 160, 197, 217, 224, 390, 483
CviJI RGCY 5 cut(s) 49, 65, 137, 178, 277
CviKI_1 RGCY 5 cut(s) 49, 65, 137, 178, 277
DdeI CTNAG 1 cut(s) 28
Eco32I GATATC 1 cut(s) 157
Eco57I CTGAAG 2 cut(s) 263, 285
EcoRII CCWGG 1 cut(s) 91
EcoRV GATATC 1 cut(s) 157
FaeI CATG 7 cut(s) 77, 163, 200, 220, 227, 393, 486
FaiI YATR 8 cut(s) 75, 161, 198, 218, 225, 391, 441, 484
FaqI GGGAC 1 cut(s) 109
FatI CATG 7 cut(s) 73, 159, 196, 216, 223, 389, 482
FokI GGATG 1 cut(s) 199
FspBI CTAG 1 cut(s) 141
GsuI CTGGAG 1 cut(s) 249
HapII CCGG 1 cut(s) 104
HgaI GACGC 1 cut(s) 215
Hin1II CATG 7 cut(s) 77, 163, 200, 220, 227, 393, 486
HincII GTYRAC 1 cut(s) 343
HindII GTYRAC 1 cut(s) 343
HindIII AAGCTT 1 cut(s) 135
HinfI GANTC 4 cut(s) 88, 97, 328, 344
HpaII CCGG 1 cut(s) 104
Hpy166II GTNNAC 1 cut(s) 343
Hpy188I TCNGA 2 cut(s) 87, 304
Hpy188III TCNNGA 2 cut(s) 128, 285
Hpy8I GTNNAC 1 cut(s) 343
HpyAV CCTTC 1 cut(s) 265
HpyCH4III ACNGT 2 cut(s) 54, 382
HpyCH4V TGCA 7 cut(s) 10, 79, 200, 370, 375, 389, 482
HpyF10VI GCNNNNNNNGC 3 cut(s) 206, 257, 266
HpyF3I CTNAG 1 cut(s) 28
Hsp92II CATG 7 cut(s) 77, 163, 200, 220, 227, 393, 486
LmnI GCTCC 2 cut(s) 175, 274
LpnPI CCDG 4 cut(s) 78, 105, 117, 213
MaeI CTAG 1 cut(s) 141
MboII GAAGA 1 cut(s) 456
MfeI CAATTG 1 cut(s) 477
MluCI AATT 3 cut(s) 252, 405, 477
MlyI GAGTC 3 cut(s) 91, 97, 338
MnlI CCTC 5 cut(s) 124, 140, 166, 331, 441
MseI TTAA 2 cut(s) 180, 333
MslI CAYNNNNRTG 1 cut(s) 438
MspI CCGG 1 cut(s) 104
MspR9I CCNGG 1 cut(s) 93
MunI CAATTG 1 cut(s) 477
MvaI CCWGG 1 cut(s) 93
MwoI GCNNNNNNNGC 3 cut(s) 206, 257, 266
NlaIII CATG 7 cut(s) 77, 163, 200, 220, 227, 393, 486
NspI RCATGY 2 cut(s) 200, 393
PaeI GCATGC 1 cut(s) 393
PfeI GAWTC 1 cut(s) 328
PleI GAGTC 3 cut(s) 91, 96, 338
PpsI GAGTC 3 cut(s) 91, 96, 338
Psp6I CCWGG 1 cut(s) 91
PspGI CCWGG 1 cut(s) 91
RseI CAYNNNNRTG 1 cut(s) 438
SaqAI TTAA 2 cut(s) 180, 333
SchI GAGTC 3 cut(s) 91, 97, 338
ScrFI CCNGG 1 cut(s) 93
SetI ASST 5 cut(s) 139, 151, 180, 279, 342
SfcI CTRYAG 1 cut(s) 50
SmiMI CAYNNNNRTG 1 cut(s) 438
SphI GCATGC 1 cut(s) 393
Sse9I AATT 3 cut(s) 252, 405, 477
SspMI CTAG 1 cut(s) 141
StyD4I CCNGG 1 cut(s) 91
TaaI ACNGT 2 cut(s) 54, 382
TaqI TCGA 1 cut(s) 286
TasI AATT 3 cut(s) 252, 405, 477
TfiI GAWTC 1 cut(s) 328
Tru1I TTAA 2 cut(s) 180, 333
Tru9I TTAA 2 cut(s) 180, 333
TscAI CASTG 2 cut(s) 120, 377
TspDTI ATGAA 2 cut(s) 212, 342
TspGWI ACGGA 1 cut(s) 199
TspRI CASTG 2 cut(s) 120, 377
XceI RCATGY 2 cut(s) 200, 393
XspI CTAG 1 cut(s) 141
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.