Basic Information

Type: gene

Biological Identity

Species

prunus_persica

Chromosome

Pp01

Orthogroup ID

OG0004892

Physical Location & Seq

Genomic Coordinates Reverse (-)

4108421 .. 4108834

Gene Structure 414 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Prupe.1G057700.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 414 bp

ATGAGTCAATCTTTGTCAAGTGTTCTTCCTCTGATGCTGCTTATGCTAGTAGCTCTCATAATATCAGTTGAGGCTGGTCTCCTTCCTAAAAAAAGAACTGTCCGAATCACCAACGCCTTGGGAGTCTACGGAGACCTCGCTGTTCATTGTAAATCCAAGGACGATGATCTTGGCGATCGCGTACTTCATCCTGGGGAGAGCTTTGAGTTTCGTTTTAGGCAAAACATTTTTGGAACCACACTGTTCTTTTGCAGCTTTAGATGGTCAAGAGAGTTTCATTACTACGATGTCTACAGAGCAGATAGAGATGGATGTAGCAAATGTTATTGGACTGTTTATTTTCTTGGCATTTGTTTTCATGATCAGAATTGTTATCCATGGCCGGTCCAGTCGGGCCGGTTCATCAACCCCTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Self-incomp_S1

Protein Analysis

138

Amino Acids

15.91

Weight (kDa)

8.23

Isoelectric Point (pI)

36.49

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004892)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_4g05610
malus_domestica	MD00G1101200.v1.1 MD05G1264800.v1.1 MD05G1264900.v1.1 MD13G1228100.v1.1 MD13G1228300.v1.1
prunus_persica	Prupe.1G057700_v2.0.a1 Prupe.1G057800_v2.0.a1 Prupe.1G058600_v2.0.a1 Prupe.1G058900_v2.0.a1 Prupe.1G059000_v2.0.a1 Prupe.1G059100_v2.0.a1 Prupe.1G059200_v2.0.a1 Prupe.1G059300_v2.0.a1 Prupe.1G059800_v2.0.a1
rosa_chinensis	RchiOBHm_Chr4g0396861 RchiOBHm_Chr7g0215481
rosa_laevigata	RLG00000002658 RLG00000009499
rosa_roxburghii	Rroxscaffold_4G00287630 Rroxscaffold_5G00341710
rosa_rugosa	Rorug01G0238300 Rorug03G0347100 Rorug07G0154000
rosa_samantha	Rh4DG068100 Rh7AG290200 Rh7BG282200 Rh7CG310200 Rh7DG294000
rosa_wichuraiana	Rw7G024780

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	2 cut(s)	126, 291
AccII	CGCG	1 cut(s)	180
AcoI	YGGCCR	1 cut(s)	380
AfaI	GTAC	1 cut(s)	183
AjnI	CCWGG	1 cut(s)	190
AluBI	AGCT	3 cut(s)	53, 201, 255
AluI	AGCT	3 cut(s)	53, 201, 255
Alw26I	GTCTC	2 cut(s)	83, 126
AoxI	GGCC	2 cut(s)	380, 394
ApeKI	GCWGC	2 cut(s)	37, 252
AsiSI	GCGATCGC	1 cut(s)	178
AspS9I	GGNCC	2 cut(s)	385, 394
AsuHPI	GGTGA	1 cut(s)	100
AvaII	GGWCC	1 cut(s)	385
BbvI	GCAGC	2 cut(s)	24, 264
BccI	CCATC	2 cut(s)	255, 302
BciT130I	CCWGG	1 cut(s)	192
BclI	TGATCA	1 cut(s)	361
BcoDI	GTCTC	2 cut(s)	83, 126
BfaI	CTAG	2 cut(s)	47, 412
BfmI	CTRYAG	1 cut(s)	292
BisI	GCNGC	2 cut(s)	38, 253
BlsI	GCNGC	2 cut(s)	39, 254
Bme1390I	CCNGG	1 cut(s)	192
Bme18I	GGWCC	1 cut(s)	385
BmgT120I	GGNCC	2 cut(s)	385, 394
BmiI	GGNNCC	1 cut(s)	235
BmrFI	CCNGG	1 cut(s)	192
BmsI	GCATC	1 cut(s)	24
BsaI	GGTCTC	2 cut(s)	83, 126
BsaJI	CCNNGG	4 cut(s)	117, 156, 191, 377
Bse118I	RCCGGY	2 cut(s)	382, 396
Bse1I	ACTGG	1 cut(s)	388
BseBI	CCWGG	1 cut(s)	192
BseDI	CCNNGG	4 cut(s)	117, 156, 191, 377
BseGI	GGATG	2 cut(s)	187, 317
BseNI	ACTGG	1 cut(s)	388
BseXI	GCAGC	2 cut(s)	24, 264
Bsh1236I	CGCG	1 cut(s)	180
Bsh1285I	CGRYCG	1 cut(s)	178
BshFI	GGCC	2 cut(s)	382, 396
BsiEI	CGRYCG	1 cut(s)	178
BsiSI	CCGG	2 cut(s)	383, 397
BsmAI	GTCTC	2 cut(s)	83, 126
BsnI	GGCC	2 cut(s)	382, 396
Bso31I	GGTCTC	2 cut(s)	83, 126
Bsp143I	GATC	3 cut(s)	166, 175, 361
Bsp19I	CCATGG	1 cut(s)	377
BspANI	GGCC	2 cut(s)	382, 396
BspFNI	CGCG	1 cut(s)	180
BspHI	TCATGA	1 cut(s)	358
BspLI	GGNNCC	1 cut(s)	235
BspTNI	GGTCTC	2 cut(s)	83, 126
BsrFI	RCCGGY	2 cut(s)	382, 396
BsrI	ACTGG	1 cut(s)	388
BssAI	RCCGGY	2 cut(s)	382, 396
BssECI	CCNNGG	4 cut(s)	117, 156, 191, 377
BssMI	GATC	3 cut(s)	166, 175, 361
BssT1I	CCWWGG	3 cut(s)	117, 156, 377
Bst2UI	CCWGG	1 cut(s)	192
Bst4CI	ACNGT	3 cut(s)	100, 243, 334
BstDSI	CCRYGG	1 cut(s)	377
BstF5I	GGATG	2 cut(s)	187, 317
BstFNI	CGCG	1 cut(s)	180
BstKTI	GATC	3 cut(s)	169, 178, 364
BstMAI	GTCTC	2 cut(s)	83, 126
BstMBI	GATC	3 cut(s)	166, 175, 361
BstMCI	CGRYCG	1 cut(s)	178
BstMWI	GCNNNNNNNGC	1 cut(s)	43
BstNI	CCWGG	1 cut(s)	192
BstSCI	CCNGG	1 cut(s)	190
BstSFI	CTRYAG	1 cut(s)	292
BstUI	CGCG	1 cut(s)	180
BstV1I	GCAGC	2 cut(s)	24, 264
BstXI	CCANNNNNNTGG	1 cut(s)	118
BsuRI	GGCC	2 cut(s)	382, 396
BtgI	CCRYGG	1 cut(s)	377
BtsCI	GGATG	2 cut(s)	187, 317
BtsIMutI	CAGTG	1 cut(s)	239
CciI	TCATGA	1 cut(s)	358
Cfr10I	RCCGGY	2 cut(s)	382, 396
Cfr13I	GGNCC	2 cut(s)	385, 394
Csp6I	GTAC	1 cut(s)	182
CviAII	CATG	2 cut(s)	359, 378
CviJI	RGCY	6 cut(s)	53, 74, 201, 255, 382, 396
CviKI_1	RGCY	6 cut(s)	53, 74, 201, 255, 382, 396
CviQI	GTAC	1 cut(s)	182
DpnI	GATC	3 cut(s)	168, 177, 363
DpnII	GATC	3 cut(s)	166, 175, 361
EaeI	YGGCCR	1 cut(s)	380
Eco130I	CCWWGG	3 cut(s)	117, 156, 377
Eco31I	GGTCTC	2 cut(s)	83, 126
Eco47I	GGWCC	1 cut(s)	385
EcoRII	CCWGG	1 cut(s)	190
EcoT14I	CCWWGG	3 cut(s)	117, 156, 377
ErhI	CCWWGG	3 cut(s)	117, 156, 377
FaeI	CATG	2 cut(s)	362, 381
FaiI	YATR	4 cut(s)	44, 59, 360, 379
FatI	CATG	2 cut(s)	358, 377
FbaI	TGATCA	1 cut(s)	361
FblI	GTMKAC	2 cut(s)	126, 291
Fnu4HI	GCNGC	2 cut(s)	38, 253
FokI	GGATG	2 cut(s)	174, 324
Fsp4HI	GCNGC	2 cut(s)	38, 253
FspBI	CTAG	2 cut(s)	47, 412
GluI	GCNGC	2 cut(s)	38, 253
HaeIII	GGCC	2 cut(s)	382, 396
HapII	CCGG	2 cut(s)	383, 397
Hin1II	CATG	2 cut(s)	362, 381
HinfI	GANTC	3 cut(s)	4, 105, 123
HpaII	CCGG	2 cut(s)	383, 397
HphI	GGTGA	1 cut(s)	100
Hpy166II	GTNNAC	2 cut(s)	127, 292
Hpy188I	TCNGA	3 cut(s)	33, 104, 366
Hpy188III	TCNNGA	2 cut(s)	267, 359
Hpy8I	GTNNAC	2 cut(s)	127, 292
HpyAV	CCTTC	1 cut(s)	92
HpyCH4III	ACNGT	3 cut(s)	100, 243, 334
HpyCH4V	TGCA	1 cut(s)	252
HpyF10VI	GCNNNNNNNGC	1 cut(s)	43
Hsp92II	CATG	2 cut(s)	362, 381
Ksp22I	TGATCA	1 cut(s)	361
Kzo9I	GATC	3 cut(s)	166, 175, 361
LpnPI	CCDG	6 cut(s)	60, 177, 204, 396, 401, 410
Lsp1109I	GCAGC	2 cut(s)	24, 264
LweI	GCATC	1 cut(s)	24
MaeI	CTAG	2 cut(s)	47, 412
MalI	GATC	3 cut(s)	168, 177, 363
MboI	GATC	3 cut(s)	166, 175, 361
MboII	GAAGA	1 cut(s)	17
MluCI	AATT	1 cut(s)	367
MlyI	GAGTC	2 cut(s)	13, 132
MnlI	CCTC	3 cut(s)	39, 64, 146
MspI	CCGG	2 cut(s)	383, 397
MspR9I	CCNGG	1 cut(s)	192
MvaI	CCWGG	1 cut(s)	192
MvnI	CGCG	1 cut(s)	180
MwoI	GCNNNNNNNGC	1 cut(s)	43
NcoI	CCATGG	1 cut(s)	377
NdeII	GATC	3 cut(s)	166, 175, 361
NlaIII	CATG	2 cut(s)	362, 381
NlaIV	GGNNCC	1 cut(s)	235
PagI	TCATGA	1 cut(s)	358
PfeI	GAWTC	1 cut(s)	105
PkrI	GCNGC	2 cut(s)	39, 254
Ple19I	CGATCG	1 cut(s)	178
PleI	GAGTC	2 cut(s)	12, 131
PpsI	GAGTC	2 cut(s)	12, 131
Psp6I	CCWGG	1 cut(s)	190
PspGI	CCWGG	1 cut(s)	190
PspN4I	GGNNCC	1 cut(s)	235
PspPI	GGNCC	2 cut(s)	385, 394
PvuI	CGATCG	1 cut(s)	178
RgaI	GCGATCGC	1 cut(s)	178
RsaI	GTAC	1 cut(s)	183
RsaNI	GTAC	1 cut(s)	182
SatI	GCNGC	2 cut(s)	38, 253
Sau3AI	GATC	3 cut(s)	166, 175, 361
Sau96I	GGNCC	2 cut(s)	385, 394
SchI	GAGTC	2 cut(s)	13, 132
ScrFI	CCNGG	1 cut(s)	192
SetI	ASST	4 cut(s)	55, 138, 203, 257
SfaAI	GCGATCGC	1 cut(s)	178
SfaNI	GCATC	1 cut(s)	24
SfcI	CTRYAG	1 cut(s)	292
SgfI	GCGATCGC	1 cut(s)	178
SinI	GGWCC	1 cut(s)	385
Sse9I	AATT	1 cut(s)	367
SspMI	CTAG	2 cut(s)	47, 412
StyD4I	CCNGG	1 cut(s)	190
StyI	CCWWGG	3 cut(s)	117, 156, 377
TaaI	ACNGT	3 cut(s)	100, 243, 334
TasI	AATT	1 cut(s)	367
TfiI	GAWTC	1 cut(s)	105
TscAI	CASTG	1 cut(s)	246
TseI	GCWGC	2 cut(s)	37, 252
TspDTI	ATGAA	5 cut(s)	134, 176, 266, 347, 391
TspGWI	ACGGA	1 cut(s)	144
TspRI	CASTG	1 cut(s)	246
VpaK11BI	GGWCC	1 cut(s)	385
XmiI	GTMKAC	2 cut(s)	126, 291
XspI	CTAG	2 cut(s)	47, 412

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.