Rh4DG068100

Plant self-incompatibility protein S1

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4D
OG0004892
Physical Location & Seq
Forward (+)
10143050 .. 10143446
397 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4DG068100.1

Sequence Viewer

Length: 315 bp
ATGAGTCTTTTCCTGAGAAATGTCCTTCATCTCTTGCTCATGCTTGTTGTTATTCTTTCAATAACAACTAGTAGTGAGGCAGGATGGGAATGGCCAAAGCGTAAGATGGTTAGTATCAGAAACTTACTGAATAACACTACTGCGACCTTAAGAGTCCAATGCAAATCGAAAGACGATGACATTGGTTGGCATGCCCTTGTTAATAGAGAGAATTTCGAATTCAAGTTCAAAACCAATTTGATTAGAACCACACTCTTCTTTTGCAGATTTGAATTTGAGGGTCAAGTTCATTACTTTCGACATTTTCAGAAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Self-incomp_S1

Protein Analysis

104

Amino Acids

12.47

Weight (kDa)

9.83

Isoelectric Point (pI)

32.27

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Self-incomp_S1 PF05938 37 - 103 9.1e-17 Plant self-incompatibility protein S1
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 92
AcsI RAATTY 3 cut(s) 211, 218, 272
AflII CTTAAG 1 cut(s) 148
AgsI TTSAA 4 cut(s) 60, 223, 229, 272
AhlI ACTAGT 1 cut(s) 68
AoxI GGCC 1 cut(s) 92
ApoI RAATTY 3 cut(s) 211, 218, 272
AsuII TTCGAA 1 cut(s) 216
BalI TGGCCA 1 cut(s) 94
BccI CCATC 2 cut(s) 78, 100
BcuI ACTAGT 1 cut(s) 68
BfaI CTAG 1 cut(s) 69
BfrI CTTAAG 1 cut(s) 148
Bpu14I TTCGAA 1 cut(s) 216
BseGI GGATG 1 cut(s) 89
BseMII CTCAG 1 cut(s) 5
BshFI GGCC 1 cut(s) 94
BsnI GGCC 1 cut(s) 94
Bsp119I TTCGAA 1 cut(s) 216
BspANI GGCC 1 cut(s) 94
BspCNI CTCAG 1 cut(s) 6
BspT104I TTCGAA 1 cut(s) 216
BspTI CTTAAG 1 cut(s) 148
Bst6I CTCTTC 1 cut(s) 260
BstAFI CTTAAG 1 cut(s) 148
BstBI TTCGAA 1 cut(s) 216
BstC8I GCNNGC 1 cut(s) 192
BstDEI CTNAG 1 cut(s) 14
BstF5I GGATG 1 cut(s) 89
BstNSI RCATGY 1 cut(s) 194
BsuRI GGCC 1 cut(s) 94
BtsCI GGATG 1 cut(s) 89
Cac8I GCNNGC 1 cut(s) 192
CviAII CATG 2 cut(s) 40, 191
CviJI RGCY 1 cut(s) 94
CviKI_1 RGCY 1 cut(s) 94
DdeI CTNAG 1 cut(s) 14
EaeI YGGCCR 1 cut(s) 92
Eam1104I CTCTTC 1 cut(s) 260
EarI CTCTTC 1 cut(s) 260
EcoRI GAATTC 1 cut(s) 218
FaeI CATG 2 cut(s) 43, 194
FaiI YATR 2 cut(s) 41, 192
FatI CATG 2 cut(s) 39, 190
FokI GGATG 1 cut(s) 96
FspBI CTAG 1 cut(s) 69
HaeIII GGCC 1 cut(s) 94
Hin1II CATG 2 cut(s) 43, 194
HinfI GANTC 2 cut(s) 4, 153
Hpy188I TCNGA 2 cut(s) 119, 309
Hpy188III TCNNGA 1 cut(s) 13
HpyAV CCTTC 1 cut(s) 35
HpyCH4V TGCA 2 cut(s) 162, 264
HpyF3I CTNAG 1 cut(s) 14
Hsp92II CATG 2 cut(s) 43, 194
LpnPI CCDG 2 cut(s) 26, 66
MaeI CTAG 1 cut(s) 69
MboII GAAGA 1 cut(s) 247
MlsI TGGCCA 1 cut(s) 94
MluCI AATT 4 cut(s) 211, 218, 235, 272
MluNI TGGCCA 1 cut(s) 94
MlyI GAGTC 2 cut(s) 13, 162
MnlI CCTC 2 cut(s) 70, 271
Mox20I TGGCCA 1 cut(s) 94
MscI TGGCCA 1 cut(s) 94
MseI TTAA 2 cut(s) 149, 201
Msp20I TGGCCA 1 cut(s) 94
MspCI CTTAAG 1 cut(s) 148
NlaIII CATG 2 cut(s) 43, 194
NspI RCATGY 1 cut(s) 194
NspV TTCGAA 1 cut(s) 216
PaeI GCATGC 1 cut(s) 194
PleI GAGTC 2 cut(s) 12, 161
PpsI GAGTC 2 cut(s) 12, 161
SaqAI TTAA 2 cut(s) 149, 201
SchI GAGTC 2 cut(s) 13, 162
SetI ASST 1 cut(s) 149
SfuI TTCGAA 1 cut(s) 216
SmlI CTYRAG 1 cut(s) 148
SmoI CTYRAG 1 cut(s) 148
SpeI ACTAGT 1 cut(s) 68
SphI GCATGC 1 cut(s) 194
Sse9I AATT 4 cut(s) 211, 218, 235, 272
SspMI CTAG 1 cut(s) 69
TaqI TCGA 3 cut(s) 167, 216, 298
TasI AATT 4 cut(s) 211, 218, 235, 272
Tru1I TTAA 2 cut(s) 149, 201
Tru9I TTAA 2 cut(s) 149, 201
TspDTI ATGAA 2 cut(s) 17, 278
Vha464I CTTAAG 1 cut(s) 148
XapI RAATTY 3 cut(s) 211, 218, 272
XceI RCATGY 1 cut(s) 194
XspI CTAG 1 cut(s) 69
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.