Rw7G024780

Plant self-incompatibility protein S1

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr7
OG0004892
Physical Location & Seq
Forward (+)
30797557 .. 30797970
414 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw7G024780.1

Sequence Viewer

Length: 414 bp
ATGATTTCCCTTGTGCTGTTGTTCTGCATCCTCACAACCACCATTGAGCACACACATGCTCTTTCGTTTTGCAAAATATTTCGATGCCCAAAGCACACCACCGTTAGAGTAACCAACCGTTTGGAAAGCAATGAGGTCCTGACCGTCCACTGTAAATCGAAAGATGATGACATCGGTGAACAAAAACTTGTGTTTGATAACGACTTTCAATTCAAGTTTAAGACAGATTTTGGCATAGTGGATAGCAGGACATTATTCTTTTGTAGCTTTCAATGGGGGAATGAATTCAAAAGGTTCGATATTTTCATTGCTAACAGGGATCGTTGCACTGAATGCTTTTGGGATGTCTATGAAAGAGGCCCGTGTTTGGAATATAACCAAGGTCAATTTGGTTATTGCCTACCGTGGAAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Self-incomp_S1

Protein Analysis

137

Amino Acids

16.29

Weight (kDa)

6.4

Isoelectric Point (pI)

18.4

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Self-incomp_S1 PF05938 34 - 136 1.5e-26 Plant self-incompatibility protein S1
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 327
AcsI RAATTY 1 cut(s) 284
AfiI CCNNNNNNNGG 1 cut(s) 367
AgsI TTSAA 4 cut(s) 209, 214, 272, 289
AluBI AGCT 1 cut(s) 267
AluI AGCT 1 cut(s) 267
Alw21I GWGCWC 1 cut(s) 51
AlwI GGATC 1 cut(s) 327
AoxI GGCC 1 cut(s) 358
ApoI RAATTY 1 cut(s) 284
Asp700I GAANNNNTTC 1 cut(s) 284
AspS9I GGNCC 2 cut(s) 136, 359
AsuHPI GGTGA 1 cut(s) 188
AvaII GGWCC 1 cut(s) 136
Bbv12I GWGCWC 1 cut(s) 51
Bme18I GGWCC 1 cut(s) 136
BmgT120I GGNCC 2 cut(s) 136, 359
BmsI GCATC 2 cut(s) 36, 74
BsaJI CCNNGG 2 cut(s) 379, 404
Bsc4I CCNNNNNNNGG 1 cut(s) 367
Bse3DI GCAATG 2 cut(s) 136, 306
BseDI CCNNGG 2 cut(s) 379, 404
BseGI GGATG 2 cut(s) 27, 349
BseLI CCNNNNNNNGG 1 cut(s) 367
BseMI GCAATG 2 cut(s) 136, 306
BshFI GGCC 1 cut(s) 360
BsiHKAI GWGCWC 1 cut(s) 51
BslI CCNNNNNNNGG 1 cut(s) 367
BsmI GAATGC 1 cut(s) 338
BsnI GGCC 1 cut(s) 360
Bsp1286I GDGCHC 1 cut(s) 51
Bsp143I GATC 1 cut(s) 319
BspANI GGCC 1 cut(s) 360
BspPI GGATC 1 cut(s) 327
BsrDI GCAATG 2 cut(s) 136, 306
BssECI CCNNGG 2 cut(s) 379, 404
BssMI GATC 1 cut(s) 319
BssT1I CCWWGG 1 cut(s) 379
Bst4CI ACNGT 5 cut(s) 103, 119, 145, 152, 405
BstAPI GCANNNNNTGC 1 cut(s) 333
BstDSI CCRYGG 1 cut(s) 404
BstF5I GGATG 2 cut(s) 27, 349
BstKTI GATC 1 cut(s) 322
BstMBI GATC 1 cut(s) 319
BstMWI GCNNNNNNNGC 1 cut(s) 333
BstNSI RCATGY 1 cut(s) 59
BstXI CCANNNNNNTGG 1 cut(s) 121
BsuRI GGCC 1 cut(s) 360
BtgI CCRYGG 1 cut(s) 404
BtsCI GGATG 2 cut(s) 27, 349
BtsIMutI CAGTG 2 cut(s) 148, 327
Cfr13I GGNCC 2 cut(s) 136, 359
CviAII CATG 1 cut(s) 56
CviJI RGCY 2 cut(s) 267, 360
CviKI_1 RGCY 2 cut(s) 267, 360
DpnI GATC 1 cut(s) 321
DpnII GATC 1 cut(s) 319
Eco130I CCWWGG 1 cut(s) 379
Eco47I GGWCC 1 cut(s) 136
EcoO109I RGGNCCY 1 cut(s) 136
EcoRI GAATTC 1 cut(s) 284
EcoT14I CCWWGG 1 cut(s) 379
ErhI CCWWGG 1 cut(s) 379
FaeI CATG 1 cut(s) 59
FaiI YATR 4 cut(s) 57, 236, 351, 375
FatI CATG 1 cut(s) 55
FokI GGATG 2 cut(s) 14, 356
HaeIII GGCC 1 cut(s) 360
Hin1II CATG 1 cut(s) 59
HphI GGTGA 1 cut(s) 188
Hpy166II GTNNAC 2 cut(s) 148, 179
Hpy188III TCNNGA 1 cut(s) 139
Hpy8I GTNNAC 2 cut(s) 148, 179
HpyCH4III ACNGT 5 cut(s) 103, 119, 145, 152, 405
HpyCH4V TGCA 3 cut(s) 27, 72, 327
HpyF10VI GCNNNNNNNGC 1 cut(s) 333
Hsp92II CATG 1 cut(s) 59
Kzo9I GATC 1 cut(s) 319
LpnPI CCDG 3 cut(s) 152, 232, 301
LweI GCATC 2 cut(s) 36, 74
MaeIII GTNAC 1 cut(s) 109
MalI GATC 1 cut(s) 321
MboI GATC 1 cut(s) 319
MhlI GDGCHC 1 cut(s) 51
MluCI AATT 3 cut(s) 209, 284, 386
MnlI CCTC 3 cut(s) 41, 127, 350
MroXI GAANNNNTTC 1 cut(s) 284
MseI TTAA 1 cut(s) 219
MslI CAYNNNNRTG 1 cut(s) 54
Mva1269I GAATGC 1 cut(s) 338
MwoI GCNNNNNNNGC 1 cut(s) 333
NdeII GATC 1 cut(s) 319
NlaIII CATG 1 cut(s) 59
NspI RCATGY 1 cut(s) 59
PctI GAATGC 1 cut(s) 338
PdmI GAANNNNTTC 1 cut(s) 284
PpuMI RGGWCCY 1 cut(s) 136
Psp5II RGGWCCY 1 cut(s) 136
PspPI GGNCC 2 cut(s) 136, 359
PspPPI RGGWCCY 1 cut(s) 136
RseI CAYNNNNRTG 1 cut(s) 54
SaqAI TTAA 1 cut(s) 219
Sau3AI GATC 1 cut(s) 319
Sau96I GGNCC 2 cut(s) 136, 359
SduI GDGCHC 1 cut(s) 51
SetI ASST 4 cut(s) 138, 269, 296, 385
SfaNI GCATC 2 cut(s) 36, 74
SinI GGWCC 1 cut(s) 136
SmiMI CAYNNNNRTG 1 cut(s) 54
Sse9I AATT 3 cut(s) 209, 284, 386
SspI AATATT 1 cut(s) 78
StyI CCWWGG 1 cut(s) 379
TaaI ACNGT 5 cut(s) 103, 119, 145, 152, 405
TaqI TCGA 3 cut(s) 82, 158, 297
TasI AATT 3 cut(s) 209, 284, 386
Tru1I TTAA 1 cut(s) 219
Tru9I TTAA 1 cut(s) 219
TscAI CASTG 2 cut(s) 155, 334
TspDTI ATGAA 3 cut(s) 295, 297, 366
TspRI CASTG 2 cut(s) 155, 334
VpaK11BI GGWCC 1 cut(s) 136
XapI RAATTY 1 cut(s) 284
XceI RCATGY 1 cut(s) 59
XcmI CCANNNNNNNNNTGG 1 cut(s) 386
XmnI GAANNNNTTC 1 cut(s) 284
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.