RchiOBHm_Chr7g0215481

Plant self-incompatibility protein S1

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
OG0004892
Physical Location & Seq
Forward (+)
33121115 .. 33121588
474 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ19280

Sequence Viewer

Length: 474 bp
ATGTTCGTTTCAATCATCATTTTTTGTTCTACTAGCAAAATGAGTCCTCTATCGAAAACTATGATTTCCCTTGTGCTGTTGTTCTGCATCCTCACAACCACCATTGAGCACACACATGCTCTTACGTTTTGCAAAATATTTCGATGCCCAAAGCACACCACCGTTAGAGTAACCAACCGTTTGGAAAGCAATGAGGTCCTGACCGTCCACTGTAAATCGAAAGATGATGACATCGGTGAACAAAAACTTGTATTTGATAACGACTTTCAATTCAAGTTTAAGACAGATTTTGGCATAGTGGATAGCAGGACATTATTCTTTTGTAGCTTTCAATGGGGGAATGAATTCAAAAGGTTCGATATTTTCATTGCTAACAGGGATCATTGCACTGAATGCTTTTGGGATGTCTTTGAAAGAGGCCCGTGTTTGGAATATAACCAAGGTCAAGTTGGTTATTGCCTACCGTGGAAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Self-incomp_S1

Protein Analysis

157

Amino Acids

18.43

Weight (kDa)

6.92

Isoelectric Point (pI)

26.69

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Self-incomp_S1 PF05938 54 - 156 1.4e-25 Plant self-incompatibility protein S1
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 387
AcsI RAATTY 1 cut(s) 344
AfiI CCNNNNNNNGG 1 cut(s) 427
AgsI TTSAA 6 cut(s) 12, 269, 274, 332, 349, 413
AluBI AGCT 1 cut(s) 327
AluI AGCT 1 cut(s) 327
Alw21I GWGCWC 1 cut(s) 111
AlwI GGATC 1 cut(s) 387
AoxI GGCC 1 cut(s) 418
ApoI RAATTY 1 cut(s) 344
Asp700I GAANNNNTTC 1 cut(s) 344
AspS9I GGNCC 2 cut(s) 196, 419
AsuHPI GGTGA 1 cut(s) 248
AvaII GGWCC 1 cut(s) 196
Bbv12I GWGCWC 1 cut(s) 111
BfaI CTAG 1 cut(s) 33
Bme18I GGWCC 1 cut(s) 196
BmgT120I GGNCC 2 cut(s) 196, 419
BmsI GCATC 2 cut(s) 96, 134
BsaJI CCNNGG 2 cut(s) 439, 464
Bsc4I CCNNNNNNNGG 1 cut(s) 427
Bse3DI GCAATG 3 cut(s) 196, 366, 382
BseDI CCNNGG 2 cut(s) 439, 464
BseGI GGATG 2 cut(s) 87, 409
BseLI CCNNNNNNNGG 1 cut(s) 427
BseMI GCAATG 3 cut(s) 196, 366, 382
BshFI GGCC 1 cut(s) 420
BsiHKAI GWGCWC 1 cut(s) 111
BslI CCNNNNNNNGG 1 cut(s) 427
BsmI GAATGC 1 cut(s) 398
BsnI GGCC 1 cut(s) 420
Bsp1286I GDGCHC 1 cut(s) 111
Bsp143I GATC 1 cut(s) 379
BspANI GGCC 1 cut(s) 420
BspPI GGATC 1 cut(s) 387
BsrDI GCAATG 3 cut(s) 196, 366, 382
BssECI CCNNGG 2 cut(s) 439, 464
BssMI GATC 1 cut(s) 379
BssT1I CCWWGG 1 cut(s) 439
Bst4CI ACNGT 5 cut(s) 163, 179, 205, 212, 465
BstAPI GCANNNNNTGC 1 cut(s) 393
BstDSI CCRYGG 1 cut(s) 464
BstF5I GGATG 2 cut(s) 87, 409
BstKTI GATC 1 cut(s) 382
BstMBI GATC 1 cut(s) 379
BstMWI GCNNNNNNNGC 1 cut(s) 393
BstNSI RCATGY 1 cut(s) 119
BstXI CCANNNNNNTGG 1 cut(s) 181
BsuRI GGCC 1 cut(s) 420
BtgI CCRYGG 1 cut(s) 464
BtsCI GGATG 2 cut(s) 87, 409
BtsIMutI CAGTG 2 cut(s) 208, 387
Cfr13I GGNCC 2 cut(s) 196, 419
CviAII CATG 1 cut(s) 116
CviJI RGCY 2 cut(s) 327, 420
CviKI_1 RGCY 2 cut(s) 327, 420
DpnI GATC 1 cut(s) 381
DpnII GATC 1 cut(s) 379
Eco130I CCWWGG 1 cut(s) 439
Eco47I GGWCC 1 cut(s) 196
EcoO109I RGGNCCY 1 cut(s) 196
EcoRI GAATTC 1 cut(s) 344
EcoT14I CCWWGG 1 cut(s) 439
ErhI CCWWGG 1 cut(s) 439
FaeI CATG 1 cut(s) 119
FaiI YATR 4 cut(s) 62, 117, 296, 435
FatI CATG 1 cut(s) 115
FokI GGATG 2 cut(s) 74, 416
FspBI CTAG 1 cut(s) 33
HaeIII GGCC 1 cut(s) 420
Hin1II CATG 1 cut(s) 119
HinfI GANTC 1 cut(s) 43
HphI GGTGA 1 cut(s) 248
Hpy166II GTNNAC 2 cut(s) 208, 239
Hpy188III TCNNGA 1 cut(s) 199
Hpy8I GTNNAC 2 cut(s) 208, 239
HpyCH4III ACNGT 5 cut(s) 163, 179, 205, 212, 465
HpyCH4IV ACGT 1 cut(s) 125
HpyCH4V TGCA 3 cut(s) 87, 132, 387
HpyF10VI GCNNNNNNNGC 1 cut(s) 393
HpySE526I ACGT 1 cut(s) 125
Hsp92II CATG 1 cut(s) 119
Kzo9I GATC 1 cut(s) 379
LpnPI CCDG 3 cut(s) 212, 292, 361
LweI GCATC 2 cut(s) 96, 134
MaeI CTAG 1 cut(s) 33
MaeII ACGT 1 cut(s) 125
MaeIII GTNAC 1 cut(s) 169
MalI GATC 1 cut(s) 381
MboI GATC 1 cut(s) 379
MhlI GDGCHC 1 cut(s) 111
MluCI AATT 2 cut(s) 269, 344
MlyI GAGTC 1 cut(s) 52
MnlI CCTC 4 cut(s) 57, 101, 187, 410
MroXI GAANNNNTTC 1 cut(s) 344
MseI TTAA 1 cut(s) 279
MslI CAYNNNNRTG 1 cut(s) 114
Mva1269I GAATGC 1 cut(s) 398
MwoI GCNNNNNNNGC 1 cut(s) 393
NdeII GATC 1 cut(s) 379
NlaIII CATG 1 cut(s) 119
NspI RCATGY 1 cut(s) 119
PctI GAATGC 1 cut(s) 398
PdmI GAANNNNTTC 1 cut(s) 344
PleI GAGTC 1 cut(s) 51
PpsI GAGTC 1 cut(s) 51
PpuMI RGGWCCY 1 cut(s) 196
Psp5II RGGWCCY 1 cut(s) 196
PspPI GGNCC 2 cut(s) 196, 419
PspPPI RGGWCCY 1 cut(s) 196
RseI CAYNNNNRTG 1 cut(s) 114
SaqAI TTAA 1 cut(s) 279
Sau3AI GATC 1 cut(s) 379
Sau96I GGNCC 2 cut(s) 196, 419
SchI GAGTC 1 cut(s) 52
SduI GDGCHC 1 cut(s) 111
SetI ASST 5 cut(s) 128, 198, 329, 356, 445
SfaNI GCATC 2 cut(s) 96, 134
SinI GGWCC 1 cut(s) 196
SmiMI CAYNNNNRTG 1 cut(s) 114
Sse9I AATT 2 cut(s) 269, 344
SspI AATATT 1 cut(s) 138
SspMI CTAG 1 cut(s) 33
StyI CCWWGG 1 cut(s) 439
TaaI ACNGT 5 cut(s) 163, 179, 205, 212, 465
TaiI ACGT 1 cut(s) 128
TaqI TCGA 4 cut(s) 53, 142, 218, 357
TasI AATT 2 cut(s) 269, 344
Tru1I TTAA 1 cut(s) 279
Tru9I TTAA 1 cut(s) 279
TscAI CASTG 2 cut(s) 215, 394
TspDTI ATGAA 2 cut(s) 355, 357
TspRI CASTG 2 cut(s) 215, 394
VpaK11BI GGWCC 1 cut(s) 196
XapI RAATTY 1 cut(s) 344
XceI RCATGY 1 cut(s) 119
XcmI CCANNNNNNNNNTGG 1 cut(s) 446
XmnI GAANNNNTTC 1 cut(s) 344
XspI CTAG 1 cut(s) 33
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.