Rroxscaffold_5G00341710

Plant self-incompatibility protein S1

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
OG0004892
Physical Location & Seq
Forward (+)
10286498 .. 10291624
5127 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00341710.1

Sequence Viewer

Length: 468 bp
ATGATCATCGGCTTCGGGGTGCATGATGATTGCCGCATGCACCTTCACGGCTGCACGTTTCCATCGTCGTCATCATCGACTTGCTCGGGCTTCTCGGCTGCACCTTCATGCCTGCACGAACTCGGTCGATTTGCCGTCGACTTCAACTCAATCGACTATCGGCGGCGACAACATGCGGGCCATGACGGATCGAGTGAGGCAGGATGGGAATGGCCAAAGTGTAAGACGGTTAGTATAAGAAACTTACTGAATAACACTACTACAACCTTAAGAGTCCATTGCAAATCGAAAGACAATGACATTGGCTGTCATGCCCTTGTTAACAGAGAGAATATCGAATTCAAGGGATTGGGGAGGCTGTTGGGACATATGTCAGAACTGGGAAAGACAAAAACAGGAGCTGCTTGGGCAGTTATCTACACATTCGGGTCAGAATCTATGTGGAGAAACCTCTGTGCAAGGGGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Self-incomp_S1

Protein Analysis

155

Amino Acids

17.13

Weight (kDa)

8.69

Isoelectric Point (pI)

49.74

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Self-incomp_S1 PF05938 76 - 115 5.8e-07 Plant self-incompatibility protein S1
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 138
AciI CCGC 3 cut(s) 34, 163, 176
AclWI GGATC 1 cut(s) 196
AcoI YGGCCR 1 cut(s) 212
AcsI RAATTY 1 cut(s) 338
AflII CTTAAG 1 cut(s) 268
AgsI TTSAA 2 cut(s) 145, 343
AluBI AGCT 1 cut(s) 401
AluI AGCT 1 cut(s) 401
AlwI GGATC 1 cut(s) 196
AlwNI CAGNNNCTG 1 cut(s) 401
Ama87I CYCGRG 1 cut(s) 85
AoxI GGCC 2 cut(s) 178, 212
ApeKI GCWGC 3 cut(s) 51, 98, 401
ApoI RAATTY 1 cut(s) 338
AspS9I GGNCC 1 cut(s) 178
AvaI CYCGRG 1 cut(s) 85
BalI TGGCCA 1 cut(s) 214
BbvI GCAGC 3 cut(s) 38, 85, 388
BccI CCATC 2 cut(s) 70, 198
BceAI ACGGC 2 cut(s) 64, 119
BclI TGATCA 1 cut(s) 3
BfrI CTTAAG 1 cut(s) 268
BisI GCNGC 5 cut(s) 34, 52, 99, 164, 402
BlsI GCNGC 5 cut(s) 35, 53, 100, 165, 403
BmeT110I CYCGRG 1 cut(s) 85
BmgT120I GGNCC 1 cut(s) 178
BmrI ACTGGG 1 cut(s) 389
BmuI ACTGGG 1 cut(s) 389
BoxI GACNNNNGTC 1 cut(s) 370
Bse1I ACTGG 1 cut(s) 384
Bse3DI GCAATG 1 cut(s) 277
BseGI GGATG 1 cut(s) 209
BseMI GCAATG 1 cut(s) 277
BseNI ACTGG 1 cut(s) 384
BseXI GCAGC 3 cut(s) 38, 85, 388
BsgI GTGCAG 3 cut(s) 37, 84, 98
Bsh1285I CGRYCG 1 cut(s) 127
BshFI GGCC 2 cut(s) 180, 214
BsiEI CGRYCG 1 cut(s) 127
BsiHKCI CYCGRG 1 cut(s) 85
BslFI GGGAC 1 cut(s) 378
BsmFI GGGAC 1 cut(s) 378
BsnI GGCC 2 cut(s) 180, 214
BsoBI CYCGRG 1 cut(s) 85
Bsp143I GATC 2 cut(s) 3, 188
BspACI CCGC 3 cut(s) 34, 163, 176
BspANI GGCC 2 cut(s) 180, 214
BspPI GGATC 1 cut(s) 196
BspTI CTTAAG 1 cut(s) 268
BsrDI GCAATG 1 cut(s) 277
BsrI ACTGG 1 cut(s) 384
BssMI GATC 2 cut(s) 3, 188
Bst4CI ACNGT 1 cut(s) 229
BstAFI CTTAAG 1 cut(s) 268
BstC8I GCNNGC 3 cut(s) 38, 113, 178
BstF5I GGATG 1 cut(s) 209
BstKTI GATC 2 cut(s) 6, 191
BstMBI GATC 2 cut(s) 3, 188
BstMCI CGRYCG 1 cut(s) 127
BstMWI GCNNNNNNNGC 1 cut(s) 407
BstNSI RCATGY 2 cut(s) 40, 176
BstPAI GACNNNNGTC 1 cut(s) 370
BstV1I GCAGC 3 cut(s) 38, 85, 388
BsuRI GGCC 2 cut(s) 180, 214
BtsCI GGATG 1 cut(s) 209
Cac8I GCNNGC 3 cut(s) 38, 113, 178
CaiI CAGNNNCTG 1 cut(s) 401
Cfr13I GGNCC 1 cut(s) 178
CviAII CATG 6 cut(s) 23, 37, 108, 173, 182, 311
CviJI RGCY 9 cut(s) 12, 51, 90, 98, 180, 214, 306, 358, 401
CviKI_1 RGCY 9 cut(s) 12, 51, 90, 98, 180, 214, 306, 358, 401
DpnI GATC 2 cut(s) 5, 190
DpnII GATC 2 cut(s) 3, 188
EaeI YGGCCR 1 cut(s) 212
Eco88I CYCGRG 1 cut(s) 85
EcoRI GAATTC 1 cut(s) 338
FaeI CATG 6 cut(s) 26, 40, 111, 176, 185, 314
FaqI GGGAC 1 cut(s) 378
FatI CATG 6 cut(s) 22, 36, 107, 172, 181, 310
FauI CCCGC 1 cut(s) 169
FauNDI CATATG 1 cut(s) 369
FbaI TGATCA 1 cut(s) 3
FblI GTMKAC 1 cut(s) 138
Fnu4HI GCNGC 5 cut(s) 34, 52, 99, 164, 402
FokI GGATG 1 cut(s) 216
Fsp4HI GCNGC 5 cut(s) 34, 52, 99, 164, 402
GluI GCNGC 5 cut(s) 34, 52, 99, 164, 402
HaeIII GGCC 2 cut(s) 180, 214
Hin1II CATG 6 cut(s) 26, 40, 111, 176, 185, 314
HincII GTYRAC 2 cut(s) 139, 322
HindII GTYRAC 2 cut(s) 139, 322
HinfI GANTC 2 cut(s) 273, 434
HpaI GTTAAC 1 cut(s) 322
Hpy166II GTNNAC 2 cut(s) 139, 322
Hpy188I TCNGA 2 cut(s) 376, 433
Hpy8I GTNNAC 2 cut(s) 139, 322
Hpy99I CGWCG 2 cut(s) 70, 140
HpyAV CCTTC 2 cut(s) 53, 114
HpyCH4III ACNGT 1 cut(s) 229
HpyCH4IV ACGT 1 cut(s) 56
HpyCH4V TGCA 7 cut(s) 22, 40, 54, 101, 115, 282, 458
HpyF10VI GCNNNNNNNGC 1 cut(s) 407
HpySE526I ACGT 1 cut(s) 56
Hsp92II CATG 6 cut(s) 26, 40, 111, 176, 185, 314
Ksp22I TGATCA 1 cut(s) 3
KspAI GTTAAC 1 cut(s) 322
Kzo9I GATC 2 cut(s) 3, 188
LmnI GCTCC 1 cut(s) 398
LpnPI CCDG 4 cut(s) 125, 186, 365, 381
Lsp1109I GCAGC 3 cut(s) 38, 85, 388
MaeII ACGT 1 cut(s) 56
MalI GATC 2 cut(s) 5, 190
MboI GATC 2 cut(s) 3, 188
MlsI TGGCCA 1 cut(s) 214
MluCI AATT 1 cut(s) 338
MluNI TGGCCA 1 cut(s) 214
MlyI GAGTC 1 cut(s) 282
MnlI CCTC 3 cut(s) 190, 348, 461
Mox20I TGGCCA 1 cut(s) 214
MscI TGGCCA 1 cut(s) 214
MseI TTAA 2 cut(s) 269, 321
MslI CAYNNNNRTG 1 cut(s) 106
Msp20I TGGCCA 1 cut(s) 214
MspCI CTTAAG 1 cut(s) 268
MwoI GCNNNNNNNGC 1 cut(s) 407
NdeI CATATG 1 cut(s) 369
NdeII GATC 2 cut(s) 3, 188
NlaIII CATG 6 cut(s) 26, 40, 111, 176, 185, 314
NmeAIII GCCGAG 1 cut(s) 74
NspI RCATGY 2 cut(s) 40, 176
PaeI GCATGC 1 cut(s) 40
PcsI WCGNNNNNNNCGW 2 cut(s) 62, 74
PfeI GAWTC 1 cut(s) 434
PkrI GCNGC 5 cut(s) 35, 53, 100, 165, 403
PleI GAGTC 1 cut(s) 281
PpsI GAGTC 1 cut(s) 281
PshAI GACNNNNGTC 1 cut(s) 370
PspPI GGNCC 1 cut(s) 178
PstNI CAGNNNCTG 1 cut(s) 401
RseI CAYNNNNRTG 1 cut(s) 106
SalI GTCGAC 1 cut(s) 137
SaqAI TTAA 2 cut(s) 269, 321
SatI GCNGC 5 cut(s) 34, 52, 99, 164, 402
Sau3AI GATC 2 cut(s) 3, 188
Sau96I GGNCC 1 cut(s) 178
SchI GAGTC 1 cut(s) 282
SetI ASST 6 cut(s) 45, 59, 106, 269, 403, 453
SmiMI CAYNNNNRTG 1 cut(s) 106
SmlI CTYRAG 1 cut(s) 268
SmoI CTYRAG 1 cut(s) 268
SphI GCATGC 1 cut(s) 40
Sse9I AATT 1 cut(s) 338
SsiI CCGC 3 cut(s) 34, 163, 176
TaaI ACNGT 1 cut(s) 229
TaiI ACGT 1 cut(s) 59
TaqI TCGA 7 cut(s) 77, 127, 138, 153, 191, 287, 336
TaqII GACCGA 1 cut(s) 113
TasI AATT 1 cut(s) 338
TauI GCSGC 2 cut(s) 36, 166
TfiI GAWTC 1 cut(s) 434
Tru1I TTAA 2 cut(s) 269, 321
Tru9I TTAA 2 cut(s) 269, 321
TseI GCWGC 3 cut(s) 51, 98, 401
TspDTI ATGAA 1 cut(s) 96
TspGWI ACGGA 1 cut(s) 201
Vha464I CTTAAG 1 cut(s) 268
XapI RAATTY 1 cut(s) 338
XceI RCATGY 2 cut(s) 40, 176
XmiI GTMKAC 1 cut(s) 138
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.