Prupe.3G029300_v2.0.a1

GMC oxidoreductase

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp03
Physical Location & Seq
Reverse (-)
2190159 .. 2190516
358 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.3G029300.1

Sequence Viewer

Length: 249 bp
AAAGTAGTGTCCATAAACCAAAATTTCCAACAGACCATATGGCACTATCATGGAGGGTGTCAAGTTGGGAGGGTTGTTGATAAAGGATATAGAGTTCTTGGTATTGATTCTCTGAGGGTTATTGATGGTTCAATGTTTTATCACACCCCAGGTGCTAATCCTCAAGCTACTGTCATGATGCTTGGAAGGTACATGGGGCAAAGGATTATGCATGACAGATTAGTCCATGGATCAAAAAAGAAAAATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

83

Amino Acids

9.33

Weight (kDa)

10.1

Isoelectric Point (pI)

26.63

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 221
AclWI GGATC 1 cut(s) 238
AcsI RAATTY 1 cut(s) 22
AfaI GTAC 1 cut(s) 191
AgsI TTSAA 1 cut(s) 132
AjnI CCWGG 1 cut(s) 148
AloI GAACNNNNNNTCC 2 cut(s) 78, 110
AluBI AGCT 1 cut(s) 167
AluI AGCT 1 cut(s) 167
AlwI GGATC 1 cut(s) 238
ApoI RAATTY 1 cut(s) 22
BccI CCATC 1 cut(s) 119
BciT130I CCWGG 1 cut(s) 150
Bme1390I CCNGG 1 cut(s) 150
BmrFI CCNGG 1 cut(s) 150
BmsI GCATC 1 cut(s) 168
BpuEI CTTGAG 1 cut(s) 147
BsaJI CCNNGG 2 cut(s) 148, 226
BseBI CCWGG 1 cut(s) 150
BseDI CCNNGG 2 cut(s) 148, 226
BseMII CTCAG 1 cut(s) 104
Bsp143I GATC 1 cut(s) 230
Bsp19I CCATGG 1 cut(s) 226
BspCNI CTCAG 1 cut(s) 105
BspHI TCATGA 1 cut(s) 174
BspPI GGATC 1 cut(s) 238
BssECI CCNNGG 2 cut(s) 148, 226
BssMI GATC 1 cut(s) 230
BssT1I CCWWGG 1 cut(s) 226
Bst2UI CCWGG 1 cut(s) 150
Bst4CI ACNGT 1 cut(s) 172
BstDEI CTNAG 1 cut(s) 113
BstDSI CCRYGG 1 cut(s) 226
BstKTI GATC 1 cut(s) 233
BstMBI GATC 1 cut(s) 230
BstNI CCWGG 1 cut(s) 150
BstSCI CCNGG 1 cut(s) 148
BtgI CCRYGG 1 cut(s) 226
CciI TCATGA 1 cut(s) 174
Csp6I GTAC 1 cut(s) 190
CviAII CATG 5 cut(s) 50, 175, 193, 212, 227
CviJI RGCY 1 cut(s) 167
CviKI_1 RGCY 1 cut(s) 167
CviQI GTAC 1 cut(s) 190
DdeI CTNAG 1 cut(s) 113
DpnI GATC 1 cut(s) 232
DpnII GATC 1 cut(s) 230
DrdI GACNNNNNNGTC 1 cut(s) 221
DseDI GACNNNNNNGTC 1 cut(s) 221
Eco130I CCWWGG 1 cut(s) 226
EcoRII CCWGG 1 cut(s) 148
EcoT14I CCWWGG 1 cut(s) 226
EcoT22I ATGCAT 1 cut(s) 213
ErhI CCWWGG 1 cut(s) 226
FaeI CATG 5 cut(s) 53, 178, 196, 215, 230
FatI CATG 5 cut(s) 49, 174, 192, 211, 226
FauNDI CATATG 1 cut(s) 38
Hin1II CATG 5 cut(s) 53, 178, 196, 215, 230
HinfI GANTC 1 cut(s) 107
Hpy188I TCNGA 1 cut(s) 114
Hpy188III TCNNGA 1 cut(s) 175
HpyAV CCTTC 1 cut(s) 180
HpyCH4III ACNGT 1 cut(s) 172
HpyCH4V TGCA 1 cut(s) 211
HpyF3I CTNAG 1 cut(s) 113
Hsp92II CATG 5 cut(s) 53, 178, 196, 215, 230
Kzo9I GATC 1 cut(s) 230
LpnPI CCDG 2 cut(s) 135, 162
LweI GCATC 1 cut(s) 168
MalI GATC 1 cut(s) 232
MboI GATC 1 cut(s) 230
MluCI AATT 2 cut(s) 22, 244
MmeI TCCRAC 1 cut(s) 52
MnlI CCTC 4 cut(s) 47, 63, 108, 171
Mph1103I ATGCAT 1 cut(s) 213
MslI CAYNNNNRTG 1 cut(s) 48
MspR9I CCNGG 1 cut(s) 150
MvaI CCWGG 1 cut(s) 150
NcoI CCATGG 1 cut(s) 226
NdeI CATATG 1 cut(s) 38
NdeII GATC 1 cut(s) 230
NlaIII CATG 5 cut(s) 53, 178, 196, 215, 230
NsiI ATGCAT 1 cut(s) 213
PagI TCATGA 1 cut(s) 174
PfeI GAWTC 1 cut(s) 107
Psp6I CCWGG 1 cut(s) 148
PspGI CCWGG 1 cut(s) 148
RsaI GTAC 1 cut(s) 191
RsaNI GTAC 1 cut(s) 190
RseI CAYNNNNRTG 1 cut(s) 48
Sau3AI GATC 1 cut(s) 230
ScrFI CCNGG 1 cut(s) 150
SetI ASST 3 cut(s) 154, 169, 191
SfaNI GCATC 1 cut(s) 168
SmiMI CAYNNNNRTG 1 cut(s) 48
SmlI CTYRAG 1 cut(s) 162
SmoI CTYRAG 1 cut(s) 162
Sse9I AATT 2 cut(s) 22, 244
StyD4I CCNGG 1 cut(s) 148
StyI CCWWGG 1 cut(s) 226
TaaI ACNGT 1 cut(s) 172
TasI AATT 2 cut(s) 22, 244
TfiI GAWTC 1 cut(s) 107
XapI RAATTY 1 cut(s) 22
Zsp2I ATGCAT 1 cut(s) 213
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.