Rh1BG371900

GMC oxidoreductase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1B
OG0005929
Physical Location & Seq
Reverse (-)
50371423 .. 50371656
234 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1BG371900.1

Sequence Viewer

Length: 234 bp
ATGGCGATAGCTGTAGACACTGTAAACGCAGTTGTGAATCGGACCCTCAGAGCTGGAGTCATAATCGAAAAAATCACAGGTCCACTCTCCACAGGTCATCTAGAGCTCAGGAACCTAGACCCTGATGACACTCCGTCTGTCACATTTAACTACTTCAAAGAGCCAGAGGACTTGAGGAGGTGCATTGAGGGTATGATGACCATTATCAGTGTGGTCAATTCCAAATCCTTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
GMC_oxred_C GMC_oxred_N

Protein Analysis

77

Amino Acids

8.52

Weight (kDa)

5.18

Isoelectric Point (pI)

36.85

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
GMC_oxred_C PF05199 28 - 75 1.6e-06 GMC oxidoreductase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 15
AgsI TTSAA 1 cut(s) 157
AhdI GACNNNNNGTC 1 cut(s) 133
AluBI AGCT 3 cut(s) 11, 53, 106
AluI AGCT 3 cut(s) 11, 53, 106
Alw21I GWGCWC 1 cut(s) 108
AspS9I GGNCC 2 cut(s) 42, 80
AvaII GGWCC 2 cut(s) 42, 80
BanII GRGCYC 1 cut(s) 108
Bbv12I GWGCWC 1 cut(s) 108
BfaI CTAG 2 cut(s) 101, 116
BfmI CTRYAG 1 cut(s) 12
Bme18I GGWCC 2 cut(s) 42, 80
BmeRI GACNNNNNGTC 1 cut(s) 133
BmgT120I GGNCC 2 cut(s) 42, 80
BmiI GGNNCC 2 cut(s) 44, 113
BpmI CTGGAG 1 cut(s) 75
Bpu10I CCTNAGC 1 cut(s) 107
BpuEI CTTGAG 1 cut(s) 193
BseMII CTCAG 2 cut(s) 61, 121
BseRI GAGGAG 1 cut(s) 190
BsiHKAI GWGCWC 1 cut(s) 108
Bsp1286I GDGCHC 1 cut(s) 108
BspCNI CTCAG 2 cut(s) 60, 120
BspLI GGNNCC 2 cut(s) 44, 113
Bst4CI ACNGT 1 cut(s) 22
BstDEI CTNAG 2 cut(s) 47, 107
BstSFI CTRYAG 1 cut(s) 12
BtsIMutI CAGTG 2 cut(s) 18, 214
Cfr13I GGNCC 2 cut(s) 42, 80
CviJI RGCY 4 cut(s) 11, 53, 106, 163
CviKI_1 RGCY 4 cut(s) 11, 53, 106, 163
DdeI CTNAG 2 cut(s) 47, 107
DriI GACNNNNNGTC 1 cut(s) 133
Eam1105I GACNNNNNGTC 1 cut(s) 133
Ecl136II GAGCTC 1 cut(s) 106
Eco24I GRGCYC 1 cut(s) 108
Eco47I GGWCC 2 cut(s) 42, 80
Eco53kI GAGCTC 1 cut(s) 106
EcoICRI GAGCTC 1 cut(s) 106
EcoT38I GRGCYC 1 cut(s) 108
FaiI YATR 2 cut(s) 62, 194
FblI GTMKAC 1 cut(s) 15
FriOI GRGCYC 1 cut(s) 108
FspBI CTAG 2 cut(s) 101, 116
GsuI CTGGAG 1 cut(s) 75
HinfI GANTC 2 cut(s) 37, 57
Hpy166II GTNNAC 3 cut(s) 16, 25, 83
Hpy188I TCNGA 2 cut(s) 42, 50
Hpy188III TCNNGA 2 cut(s) 101, 109
Hpy8I GTNNAC 3 cut(s) 16, 25, 83
HpyCH4III ACNGT 1 cut(s) 22
HpyCH4V TGCA 1 cut(s) 183
HpyF3I CTNAG 2 cut(s) 47, 107
LpnPI CCDG 6 cut(s) 39, 63, 78, 94, 135, 177
MaeI CTAG 2 cut(s) 101, 116
MaeIII GTNAC 1 cut(s) 139
MhlI GDGCHC 1 cut(s) 108
MluCI AATT 1 cut(s) 217
MlyI GAGTC 1 cut(s) 66
MnlI CCTC 5 cut(s) 56, 160, 168, 171, 181
MseI TTAA 1 cut(s) 147
NlaIV GGNNCC 2 cut(s) 44, 113
NmuCI GTSAC 1 cut(s) 139
PfeI GAWTC 1 cut(s) 37
PleI GAGTC 1 cut(s) 65
PpsI GAGTC 1 cut(s) 65
Psp124BI GAGCTC 1 cut(s) 108
PspN4I GGNNCC 2 cut(s) 44, 113
PspPI GGNCC 2 cut(s) 42, 80
SacI GAGCTC 1 cut(s) 108
SaqAI TTAA 1 cut(s) 147
Sau96I GGNCC 2 cut(s) 42, 80
SchI GAGTC 1 cut(s) 66
SduI GDGCHC 1 cut(s) 108
SetI ASST 7 cut(s) 13, 55, 82, 97, 108, 117, 182
SfcI CTRYAG 1 cut(s) 12
SgeI CNNG 9 cut(s) 66, 90, 105, 113, 121, 128, 134, 176, 184
SinI GGWCC 2 cut(s) 42, 80
SmlI CTYRAG 1 cut(s) 172
SmoI CTYRAG 1 cut(s) 172
Sse9I AATT 1 cut(s) 217
SspMI CTAG 2 cut(s) 101, 116
SstI GAGCTC 1 cut(s) 108
TaaI ACNGT 1 cut(s) 22
TaqI TCGA 1 cut(s) 66
TasI AATT 1 cut(s) 217
TfiI GAWTC 1 cut(s) 37
Tru1I TTAA 1 cut(s) 147
Tru9I TTAA 1 cut(s) 147
TscAI CASTG 2 cut(s) 25, 214
TseFI GTSAC 1 cut(s) 139
Tsp45I GTSAC 1 cut(s) 139
TspGWI ACGGA 1 cut(s) 123
TspRI CASTG 2 cut(s) 25, 214
VpaK11BI GGWCC 2 cut(s) 42, 80
XbaI TCTAGA 1 cut(s) 100
XcmI CCANNNNNNNNNTGG 1 cut(s) 208
XmiI GTMKAC 1 cut(s) 15
XspI CTAG 2 cut(s) 101, 116
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.