Prupe.7G168200_v2.0.a1

Gibberellin-regulated protein 11-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp07
OG0004300
Physical Location & Seq
Reverse (-)
17124971 .. 17125908
938 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.7G168200.1

Sequence Viewer

Length: 471 bp
ATGCACCACCCCGCCCCCTCTTTTCTGATCAATCTCTCTATAAATACTCACTCCGATCTCTCTCTCATTTCACAACATCCCAATTATCTTCTCTCTCTACTAGCTGCTATAGCTATAGCTATTTTCTATATAAATATAATTAATATGGCCTTGTCATCAAGATTAACCCTGATGATGGCTTCCCTTGTTTTCTCTTTTCTGGTTCTCCAATATCTCACTGAAGCAGCTCATCAGTCCCACATGATGAACAACAATGGAGCACCGAGCCCCCTACCCCCGCCCACCCTAGATTGCGGAGTGGCATGTGAAGGAAGGTGCAAATTATCATCAAGGCCTCGTCTGTGCAAAAGGGCTTGTGGGAGTTGCTGTGACAAGTGTAGCTGTGTTCCTCCAGGCACTGCTGGCAACTATGAGGCTTGTCCTTGCTATGCTAGCCTCACCACCCGCAATCAAACCCGAAAATGCCCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
GASA

Protein Analysis

157

Amino Acids

16.9

Weight (kDa)

8.64

Isoelectric Point (pI)

61.13

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 4 cut(s) 12, 278, 294, 445
AcuI CTGAAG 1 cut(s) 240
AfiI CCNNNNNNNGG 1 cut(s) 175
AjnI CCWGG 1 cut(s) 391
AluBI AGCT 5 cut(s) 104, 113, 119, 227, 381
AluI AGCT 5 cut(s) 104, 113, 119, 227, 381
Alw21I GWGCWC 1 cut(s) 262
AlwNI CAGNNNCTG 1 cut(s) 398
AoxI GGCC 2 cut(s) 147, 332
ApeKI GCWGC 2 cut(s) 104, 224
AseI ATTAAT 1 cut(s) 141
AsuHPI GGTGA 1 cut(s) 430
AsuNHI GCTAGC 1 cut(s) 431
BanII GRGCYC 1 cut(s) 269
Bbv12I GWGCWC 1 cut(s) 262
BbvI GCAGC 2 cut(s) 91, 236
BccI CCATC 1 cut(s) 169
BciT130I CCWGG 1 cut(s) 393
BclI TGATCA 1 cut(s) 27
BfaI CTAG 3 cut(s) 101, 287, 432
BfmI CTRYAG 2 cut(s) 108, 114
BisI GCNGC 2 cut(s) 105, 225
BlsI GCNGC 2 cut(s) 106, 226
Bme1390I CCNGG 1 cut(s) 393
BmrFI CCNGG 1 cut(s) 393
BmtI GCTAGC 1 cut(s) 435
BpmI CTGGAG 1 cut(s) 375
BsaXI ACNNNNNCTCC 2 cut(s) 352, 382
Bsc4I CCNNNNNNNGG 1 cut(s) 175
BseBI CCWGG 1 cut(s) 393
BseGI GGATG 1 cut(s) 76
BseLI CCNNNNNNNGG 1 cut(s) 175
BseXI GCAGC 2 cut(s) 91, 236
BshFI GGCC 2 cut(s) 149, 334
BsiHKAI GWGCWC 1 cut(s) 262
BslFI GGGAC 1 cut(s) 220
BslI CCNNNNNNNGG 1 cut(s) 175
BsmFI GGGAC 1 cut(s) 220
BsnI GGCC 2 cut(s) 149, 334
Bsp1286I GDGCHC 2 cut(s) 262, 269
Bsp143I GATC 2 cut(s) 27, 55
BspACI CCGC 4 cut(s) 12, 278, 294, 445
BspANI GGCC 2 cut(s) 149, 334
BspOI GCTAGC 1 cut(s) 435
BssMI GATC 2 cut(s) 27, 55
Bst2UI CCWGG 1 cut(s) 393
BstC8I GCNNGC 2 cut(s) 403, 433
BstF5I GGATG 1 cut(s) 76
BstKTI GATC 2 cut(s) 30, 58
BstMBI GATC 2 cut(s) 27, 55
BstMWI GCNNNNNNNGC 3 cut(s) 110, 402, 432
BstNI CCWGG 1 cut(s) 393
BstNSI RCATGY 1 cut(s) 306
BstSCI CCNGG 1 cut(s) 391
BstSFI CTRYAG 2 cut(s) 108, 114
BstV1I GCAGC 2 cut(s) 91, 236
BsuRI GGCC 2 cut(s) 149, 334
BtsCI GGATG 1 cut(s) 76
BtsI GCAGTG 1 cut(s) 396
BtsIMutI CAGTG 2 cut(s) 216, 396
Cac8I GCNNGC 2 cut(s) 403, 433
CaiI CAGNNNCTG 1 cut(s) 398
CviAII CATG 2 cut(s) 241, 303
DpnI GATC 2 cut(s) 29, 57
DpnII GATC 2 cut(s) 27, 55
Eco147I AGGCCT 1 cut(s) 334
Eco24I GRGCYC 1 cut(s) 269
Eco57I CTGAAG 1 cut(s) 240
EcoRII CCWGG 1 cut(s) 391
EcoT38I GRGCYC 1 cut(s) 269
FaeI CATG 2 cut(s) 244, 306
FaqI GGGAC 1 cut(s) 220
FatI CATG 2 cut(s) 240, 302
FauI CCCGC 3 cut(s) 19, 285, 452
FbaI TGATCA 1 cut(s) 27
Fnu4HI GCNGC 2 cut(s) 105, 225
FokI GGATG 1 cut(s) 63
FriOI GRGCYC 1 cut(s) 269
Fsp4HI GCNGC 2 cut(s) 105, 225
FspBI CTAG 3 cut(s) 101, 287, 432
GluI GCNGC 2 cut(s) 105, 225
GsuI CTGGAG 1 cut(s) 375
HaeIII GGCC 2 cut(s) 149, 334
Hin1II CATG 2 cut(s) 244, 306
HphI GGTGA 1 cut(s) 430
Hpy188I TCNGA 2 cut(s) 27, 55
Hpy188III TCNNGA 1 cut(s) 159
HpyAV CCTTC 2 cut(s) 302, 306
HpyCH4V TGCA 3 cut(s) 4, 318, 345
HpyF10VI GCNNNNNNNGC 3 cut(s) 110, 402, 432
Hsp92II CATG 2 cut(s) 244, 306
Ksp22I TGATCA 1 cut(s) 27
Kzo9I GATC 2 cut(s) 27, 55
LmnI GCTCC 1 cut(s) 257
LpnPI CCDG 5 cut(s) 182, 185, 378, 387, 405
Lsp1109I GCAGC 2 cut(s) 91, 236
MaeI CTAG 3 cut(s) 101, 287, 432
MaeIII GTNAC 1 cut(s) 368
MalI GATC 2 cut(s) 29, 57
MboI GATC 2 cut(s) 27, 55
MboII GAAGA 1 cut(s) 80
MhlI GDGCHC 2 cut(s) 262, 269
MluCI AATT 3 cut(s) 82, 138, 320
MnlI CCTC 5 cut(s) 28, 345, 399, 406, 446
MseI TTAA 3 cut(s) 141, 164, 469
MspR9I CCNGG 1 cut(s) 393
MvaI CCWGG 1 cut(s) 393
MwoI GCNNNNNNNGC 3 cut(s) 110, 402, 432
NdeII GATC 2 cut(s) 27, 55
NheI GCTAGC 1 cut(s) 431
NlaIII CATG 2 cut(s) 244, 306
NmuCI GTSAC 1 cut(s) 368
NspI RCATGY 1 cut(s) 306
PceI AGGCCT 1 cut(s) 334
PkrI GCNGC 2 cut(s) 106, 226
PshBI ATTAAT 1 cut(s) 141
Psp6I CCWGG 1 cut(s) 391
PspGI CCWGG 1 cut(s) 391
PstNI CAGNNNCTG 1 cut(s) 398
SaqAI TTAA 3 cut(s) 141, 164, 469
SatI GCNGC 2 cut(s) 105, 225
Sau3AI GATC 2 cut(s) 27, 55
ScrFI CCNGG 1 cut(s) 393
SduI GDGCHC 2 cut(s) 262, 269
SetI ASST 6 cut(s) 106, 115, 121, 229, 317, 383
SfcI CTRYAG 2 cut(s) 108, 114
Sse9I AATT 3 cut(s) 82, 138, 320
SseBI AGGCCT 1 cut(s) 334
SsiI CCGC 4 cut(s) 12, 278, 294, 445
SspMI CTAG 3 cut(s) 101, 287, 432
StuI AGGCCT 1 cut(s) 334
StyD4I CCNGG 1 cut(s) 391
TasI AATT 3 cut(s) 82, 138, 320
Tru1I TTAA 3 cut(s) 141, 164, 469
Tru9I TTAA 3 cut(s) 141, 164, 469
TscAI CASTG 2 cut(s) 223, 403
TseFI GTSAC 1 cut(s) 368
TseI GCWGC 2 cut(s) 104, 224
Tsp45I GTSAC 1 cut(s) 368
TspDTI ATGAA 1 cut(s) 260
TspRI CASTG 2 cut(s) 223, 403
VspI ATTAAT 1 cut(s) 141
XceI RCATGY 1 cut(s) 306
XspI CTAG 3 cut(s) 101, 287, 432
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.