Rroxscaffold_7G00165300

Gibberellin-regulated protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
OG0004300
Physical Location & Seq
Forward (+)
7088914 .. 7089870
957 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00165300.1

Sequence Viewer

Length: 300 bp
ATGATGTTCAAGGCTCTAATTGCTCAACTTCTCGTTTCTTTTCTCATTCTCCAACTTGTTAGTTCTGATTTTCAGGTGACCACACCTCCTGTTGGATCCCCTATTTCCCCAAAAATAGATTGTGATGGAACTTGTAACGTAAGGTGCGGTTTATCGTCAAGGCCAGATCTATGCAAGAGGGCATGTGGGACGTGCTGTGCCAGATGCGGTTGTGTTCCACCTGGCACCTCCGGTCACTATGAAGTTTGTCCTTGCTACGGCAATATGACCACTCACGGGGGAAGACGCAAATGCCCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
GASA

Protein Analysis

99

Amino Acids

10.53

Weight (kDa)

8.66

Isoelectric Point (pI)

50.04

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
GASA PF02704 40 - 99 3.6e-21 Gibberellin regulated protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 224
AciI CCGC 2 cut(s) 147, 207
AclWI GGATC 2 cut(s) 90, 103
AfiI CCNNNNNNNGG 3 cut(s) 92, 257, 276
AgsI TTSAA 1 cut(s) 10
AjiI CACGTC 1 cut(s) 192
AjnI CCWGG 1 cut(s) 220
AlwI GGATC 2 cut(s) 90, 103
AoxI GGCC 1 cut(s) 161
AsuHPI GGTGA 1 cut(s) 88
BamHI GGATCC 1 cut(s) 95
BanI GGYRCC 1 cut(s) 224
BbsI GAAGAC 1 cut(s) 289
BccI CCATC 1 cut(s) 119
BceAI ACGGC 1 cut(s) 274
BciT130I CCWGG 1 cut(s) 222
BglII AGATCT 1 cut(s) 166
Bme1390I CCNGG 1 cut(s) 222
BmgBI CACGTC 1 cut(s) 192
BmiI GGNNCC 2 cut(s) 97, 226
BmrFI CCNGG 1 cut(s) 222
BmsI GCATC 1 cut(s) 194
BpiI GAAGAC 1 cut(s) 289
BsaWI WCCGGW 1 cut(s) 230
BsaXI ACNNNNNCTCC 2 cut(s) 70, 100
Bsc4I CCNNNNNNNGG 3 cut(s) 92, 257, 276
BseBI CCWGG 1 cut(s) 222
BseLI CCNNNNNNNGG 3 cut(s) 92, 257, 276
BshFI GGCC 1 cut(s) 163
BshNI GGYRCC 1 cut(s) 224
BsiSI CCGG 1 cut(s) 231
BslFI GGGAC 1 cut(s) 202
BslI CCNNNNNNNGG 3 cut(s) 92, 257, 276
BsmFI GGGAC 1 cut(s) 202
BsnI GGCC 1 cut(s) 163
Bsp143I GATC 2 cut(s) 95, 166
BspACI CCGC 2 cut(s) 147, 207
BspANI GGCC 1 cut(s) 163
BspLI GGNNCC 2 cut(s) 97, 226
BspPI GGATC 2 cut(s) 90, 103
BspT107I GGYRCC 1 cut(s) 224
BssMI GATC 2 cut(s) 95, 166
Bst2UI CCWGG 1 cut(s) 222
BstEII GGTNACC 1 cut(s) 76
BstKTI GATC 2 cut(s) 98, 169
BstMBI GATC 2 cut(s) 95, 166
BstMWI GCNNNNNNNGC 1 cut(s) 20
BstNI CCWGG 1 cut(s) 222
BstNSI RCATGY 1 cut(s) 186
BstPI GGTNACC 1 cut(s) 76
BstSCI CCNGG 1 cut(s) 220
BstV2I GAAGAC 1 cut(s) 289
BstX2I RGATCY 2 cut(s) 95, 166
BstYI RGATCY 2 cut(s) 95, 166
BsuRI GGCC 1 cut(s) 163
BtrI CACGTC 1 cut(s) 192
CseI GACGC 1 cut(s) 294
CviAII CATG 1 cut(s) 183
CviJI RGCY 2 cut(s) 14, 163
CviKI_1 RGCY 2 cut(s) 14, 163
DpnI GATC 2 cut(s) 97, 168
DpnII GATC 2 cut(s) 95, 166
Eco91I GGTNACC 1 cut(s) 76
EcoO65I GGTNACC 1 cut(s) 76
EcoRII CCWGG 1 cut(s) 220
FaeI CATG 1 cut(s) 186
FaiI YATR 4 cut(s) 172, 184, 240, 266
FaqI GGGAC 1 cut(s) 202
FatI CATG 1 cut(s) 182
HaeIII GGCC 1 cut(s) 163
HapII CCGG 1 cut(s) 231
HgaI GACGC 1 cut(s) 294
Hin1II CATG 1 cut(s) 186
HpaII CCGG 1 cut(s) 231
HphI GGTGA 1 cut(s) 88
Hpy188I TCNGA 1 cut(s) 67
HpyCH4IV ACGT 2 cut(s) 138, 191
HpyCH4V TGCA 1 cut(s) 174
HpyF10VI GCNNNNNNNGC 1 cut(s) 20
HpySE526I ACGT 2 cut(s) 138, 191
Hsp92II CATG 1 cut(s) 186
Kzo9I GATC 2 cut(s) 95, 166
LpnPI CCDG 7 cut(s) 59, 102, 177, 207, 214, 234, 244
LweI GCATC 1 cut(s) 194
MaeII ACGT 2 cut(s) 138, 191
MaeIII GTNAC 3 cut(s) 76, 134, 233
MalI GATC 2 cut(s) 97, 168
MboI GATC 2 cut(s) 95, 166
MboII GAAGA 1 cut(s) 294
MflI RGATCY 2 cut(s) 95, 166
MluCI AATT 1 cut(s) 18
MmeI TCCRAC 2 cut(s) 73, 76
MnlI CCTC 3 cut(s) 96, 171, 238
MspI CCGG 1 cut(s) 231
MspR9I CCNGG 1 cut(s) 222
MvaI CCWGG 1 cut(s) 222
MwoI GCNNNNNNNGC 1 cut(s) 20
NdeII GATC 2 cut(s) 95, 166
NlaIII CATG 1 cut(s) 186
NlaIV GGNNCC 2 cut(s) 97, 226
NmuCI GTSAC 2 cut(s) 76, 233
NspI RCATGY 1 cut(s) 186
Psp6I CCWGG 1 cut(s) 220
PspEI GGTNACC 1 cut(s) 76
PspGI CCWGG 1 cut(s) 220
PspN4I GGNNCC 2 cut(s) 97, 226
PsuI RGATCY 2 cut(s) 95, 166
Sau3AI GATC 2 cut(s) 95, 166
ScrFI CCNGG 1 cut(s) 222
SetI ASST 7 cut(s) 78, 88, 141, 146, 194, 223, 230
SfaNI GCATC 1 cut(s) 194
Sse9I AATT 1 cut(s) 18
SsiI CCGC 2 cut(s) 147, 207
StyD4I CCNGG 1 cut(s) 220
TaiI ACGT 2 cut(s) 141, 194
TasI AATT 1 cut(s) 18
TseFI GTSAC 2 cut(s) 76, 233
Tsp45I GTSAC 2 cut(s) 76, 233
TspDTI ATGAA 1 cut(s) 255
XceI RCATGY 1 cut(s) 186
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.