Rw6G037300

Gibberellin-regulated protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr6
OG0004300
Physical Location & Seq
Reverse (-)
61677771 .. 61678784
1014 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw6G037300.1

Sequence Viewer

Length: 300 bp
ATGATGTTCAAGGCTCTAATTGCTCAACTTCTCGTTTCTTTTATCATTCTCCAACTTGTTAGTTCTGCTTTTCAGGTGACCACACCTCCTGTTGGATCCCCTATTTCCCCAAAAATAGATTGTGATGGAGCTTGTAACGTAAGGTGTGGTTTATCGTCAAGGCCAAATCTATGCAAGAGGGCATGTGGGACGTGCTGTTCCAGATGCAGTTGCGTTCCACCCGGCACTTCCGGTCACTATGAAGTTTGTCCTTGCTACGGCAATATAACCACTCACGGGGGAAGACGCAAATGCCCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
GASA

Protein Analysis

99

Amino Acids

10.48

Weight (kDa)

8.93

Isoelectric Point (pI)

65.97

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
GASA PF02704 40 - 99 3e-21 Gibberellin regulated protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 90, 103
AfiI CCNNNNNNNGG 3 cut(s) 92, 257, 276
AgsI TTSAA 1 cut(s) 10
AjiI CACGTC 1 cut(s) 192
AloI GAACNNNNNNTCC 2 cut(s) 181, 213
AluBI AGCT 1 cut(s) 131
AluI AGCT 1 cut(s) 131
AlwI GGATC 2 cut(s) 90, 103
AoxI GGCC 1 cut(s) 161
AsuC2I CCSGG 1 cut(s) 222
AsuHPI GGTGA 1 cut(s) 88
BamHI GGATCC 1 cut(s) 95
BbsI GAAGAC 1 cut(s) 289
BccI CCATC 1 cut(s) 119
BceAI ACGGC 1 cut(s) 274
BcnI CCSGG 1 cut(s) 222
Bme1390I CCNGG 1 cut(s) 222
BmgBI CACGTC 1 cut(s) 192
BmiI GGNNCC 1 cut(s) 97
BmrFI CCNGG 1 cut(s) 222
BmsI GCATC 1 cut(s) 194
BpiI GAAGAC 1 cut(s) 289
BpuMI CCSGG 1 cut(s) 222
BsaWI WCCGGW 1 cut(s) 230
BsaXI ACNNNNNCTCC 2 cut(s) 70, 100
Bsc4I CCNNNNNNNGG 3 cut(s) 92, 257, 276
BseLI CCNNNNNNNGG 3 cut(s) 92, 257, 276
BshFI GGCC 1 cut(s) 163
BsiSI CCGG 2 cut(s) 222, 231
BslFI GGGAC 1 cut(s) 202
BslI CCNNNNNNNGG 3 cut(s) 92, 257, 276
BsmFI GGGAC 1 cut(s) 202
BsnI GGCC 1 cut(s) 163
Bsp143I GATC 1 cut(s) 95
BspANI GGCC 1 cut(s) 163
BspLI GGNNCC 1 cut(s) 97
BspPI GGATC 2 cut(s) 90, 103
BssMI GATC 1 cut(s) 95
BstEII GGTNACC 1 cut(s) 76
BstKTI GATC 1 cut(s) 98
BstMBI GATC 1 cut(s) 95
BstMWI GCNNNNNNNGC 1 cut(s) 20
BstNSI RCATGY 1 cut(s) 186
BstPI GGTNACC 1 cut(s) 76
BstSCI CCNGG 1 cut(s) 220
BstV2I GAAGAC 1 cut(s) 289
BstX2I RGATCY 1 cut(s) 95
BstYI RGATCY 1 cut(s) 95
BsuRI GGCC 1 cut(s) 163
BtrI CACGTC 1 cut(s) 192
CseI GACGC 1 cut(s) 294
CviAII CATG 1 cut(s) 183
CviJI RGCY 3 cut(s) 14, 131, 163
CviKI_1 RGCY 3 cut(s) 14, 131, 163
DpnI GATC 1 cut(s) 97
DpnII GATC 1 cut(s) 95
Eco91I GGTNACC 1 cut(s) 76
EcoO65I GGTNACC 1 cut(s) 76
FaeI CATG 1 cut(s) 186
FaiI YATR 4 cut(s) 172, 184, 240, 266
FaqI GGGAC 1 cut(s) 202
FatI CATG 1 cut(s) 182
HaeIII GGCC 1 cut(s) 163
HapII CCGG 2 cut(s) 222, 231
HgaI GACGC 1 cut(s) 294
Hin1II CATG 1 cut(s) 186
HpaII CCGG 2 cut(s) 222, 231
HphI GGTGA 1 cut(s) 88
Hpy188III TCNNGA 1 cut(s) 201
HpyCH4IV ACGT 2 cut(s) 138, 191
HpyCH4V TGCA 2 cut(s) 174, 207
HpyF10VI GCNNNNNNNGC 1 cut(s) 20
HpySE526I ACGT 2 cut(s) 138, 191
Hsp92II CATG 1 cut(s) 186
Kzo9I GATC 1 cut(s) 95
LmnI GCTCC 1 cut(s) 128
LpnPI CCDG 5 cut(s) 59, 102, 214, 235, 244
LweI GCATC 1 cut(s) 194
MaeII ACGT 2 cut(s) 138, 191
MaeIII GTNAC 3 cut(s) 76, 134, 233
MalI GATC 1 cut(s) 97
MboI GATC 1 cut(s) 95
MboII GAAGA 1 cut(s) 294
MflI RGATCY 1 cut(s) 95
MluCI AATT 1 cut(s) 18
MmeI TCCRAC 2 cut(s) 73, 76
MnlI CCTC 2 cut(s) 96, 171
MseI TTAA 1 cut(s) 298
MspI CCGG 2 cut(s) 222, 231
MspR9I CCNGG 1 cut(s) 222
MwoI GCNNNNNNNGC 1 cut(s) 20
NciI CCSGG 1 cut(s) 222
NdeII GATC 1 cut(s) 95
NlaIII CATG 1 cut(s) 186
NlaIV GGNNCC 1 cut(s) 97
NmuCI GTSAC 2 cut(s) 76, 233
NspI RCATGY 1 cut(s) 186
PspEI GGTNACC 1 cut(s) 76
PspN4I GGNNCC 1 cut(s) 97
PsuI RGATCY 1 cut(s) 95
SaqAI TTAA 1 cut(s) 298
Sau3AI GATC 1 cut(s) 95
ScrFI CCNGG 1 cut(s) 222
SetI ASST 6 cut(s) 78, 88, 133, 141, 146, 194
SfaNI GCATC 1 cut(s) 194
Sse9I AATT 1 cut(s) 18
StyD4I CCNGG 1 cut(s) 220
TaiI ACGT 2 cut(s) 141, 194
TasI AATT 1 cut(s) 18
Tru1I TTAA 1 cut(s) 298
Tru9I TTAA 1 cut(s) 298
TseFI GTSAC 2 cut(s) 76, 233
Tsp45I GTSAC 2 cut(s) 76, 233
TspDTI ATGAA 1 cut(s) 255
XceI RCATGY 1 cut(s) 186
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.