pycom03g11130

DnaJ protein homolog

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr3
OG0006961
Physical Location & Seq
Forward (+)
10765047 .. 10765572
526 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom03g11130.1

Sequence Viewer

Length: 186 bp
ATGTTTGGGAGGACGCCGAAGAAGAGCGATAACACTCGGTACTATGAGATTTTGGGAGTTTCGCAGAGTGCTTCTTCCGACGATTTGAAGAAGGCGTATAAGAAAGCCGCCATAAAAAACCACCCTGATAAGGGTGGATCGATCCTGAGAAATTTAAAGAGTTGGCTCACGCTTATGAGGTTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04141 map04141
Pfam Domains
Protein Families
DnaJ DnaJ_C DnaJ_CXXCXGXG

Protein Analysis

62

Amino Acids

6.96

Weight (kDa)

10.14

Isoelectric Point (pI)

30.31

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DnaJ PF00226 14 - 45 9.3e-12 DnaJ domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 108
AclWI GGATC 2 cut(s) 136, 145
AcsI RAATTY 1 cut(s) 151
AcyI GRCGYC 1 cut(s) 14
AfaI GTAC 1 cut(s) 41
AfiI CCNNNNNNNGG 2 cut(s) 130, 131
AgsI TTSAA 1 cut(s) 88
AlwI GGATC 2 cut(s) 136, 145
ApoI RAATTY 1 cut(s) 151
BisI GCNGC 1 cut(s) 108
BlsI GCNGC 1 cut(s) 109
Bsa29I ATCGAT 1 cut(s) 140
BsaHI GRCGYC 1 cut(s) 14
Bsc4I CCNNNNNNNGG 2 cut(s) 130, 131
BseCI ATCGAT 1 cut(s) 140
BseLI CCNNNNNNNGG 2 cut(s) 130, 131
BseMII CTCAG 1 cut(s) 137
BshVI ATCGAT 1 cut(s) 140
BslI CCNNNNNNNGG 2 cut(s) 130, 131
Bsp143I GATC 2 cut(s) 137, 141
BspACI CCGC 1 cut(s) 108
BspCNI CTCAG 1 cut(s) 138
BspDI ATCGAT 1 cut(s) 140
BspPI GGATC 2 cut(s) 136, 145
BspQI GCTCTTC 1 cut(s) 17
BssMI GATC 2 cut(s) 137, 141
BssNI GRCGYC 1 cut(s) 14
Bst6I CTCTTC 1 cut(s) 17
BstACI GRCGYC 1 cut(s) 14
BstDEI CTNAG 1 cut(s) 146
BstKTI GATC 2 cut(s) 140, 144
BstMBI GATC 2 cut(s) 137, 141
Bsu15I ATCGAT 1 cut(s) 140
BsuTUI ATCGAT 1 cut(s) 140
ClaI ATCGAT 1 cut(s) 140
CseI GACGC 1 cut(s) 22
Csp6I GTAC 1 cut(s) 40
CviJI RGCY 2 cut(s) 107, 166
CviKI_1 RGCY 2 cut(s) 107, 166
CviQI GTAC 1 cut(s) 40
DdeI CTNAG 1 cut(s) 146
DpnI GATC 2 cut(s) 139, 143
DpnII GATC 2 cut(s) 137, 141
DraI TTTAAA 1 cut(s) 156
Eam1104I CTCTTC 1 cut(s) 17
EarI CTCTTC 1 cut(s) 17
FaiI YATR 4 cut(s) 45, 99, 113, 176
Fnu4HI GCNGC 1 cut(s) 108
Fsp4HI GCNGC 1 cut(s) 108
GluI GCNGC 1 cut(s) 108
HgaI GACGC 1 cut(s) 22
Hin1I GRCGYC 1 cut(s) 14
Hpy188I TCNGA 1 cut(s) 79
Hpy188III TCNNGA 1 cut(s) 145
Hpy99I CGWCG 1 cut(s) 83
HpyAV CCTTC 1 cut(s) 85
HpyF3I CTNAG 1 cut(s) 146
Hsp92I GRCGYC 1 cut(s) 14
Kzo9I GATC 2 cut(s) 137, 141
LguI GCTCTTC 1 cut(s) 17
LpnPI CCDG 2 cut(s) 138, 158
MalI GATC 2 cut(s) 139, 143
MboI GATC 2 cut(s) 137, 141
MboII GAAGA 4 cut(s) 31, 34, 66, 100
MluCI AATT 1 cut(s) 151
MmeI TCCRAC 1 cut(s) 102
MnlI CCTC 2 cut(s) 3, 171
MseI TTAA 1 cut(s) 155
MslI CAYNNNNRTG 1 cut(s) 173
NdeII GATC 2 cut(s) 137, 141
PciSI GCTCTTC 1 cut(s) 17
PkrI GCNGC 1 cut(s) 109
RsaI GTAC 1 cut(s) 41
RsaNI GTAC 1 cut(s) 40
RseI CAYNNNNRTG 1 cut(s) 173
SapI GCTCTTC 1 cut(s) 17
SaqAI TTAA 1 cut(s) 155
SatI GCNGC 1 cut(s) 108
Sau3AI GATC 2 cut(s) 137, 141
SetI ASST 1 cut(s) 182
SgeI CNNG 4 cut(s) 48, 137, 157, 181
SmiMI CAYNNNNRTG 1 cut(s) 173
Sse9I AATT 1 cut(s) 151
SsiI CCGC 1 cut(s) 108
TaqI TCGA 1 cut(s) 140
TasI AATT 1 cut(s) 151
TauI GCSGC 1 cut(s) 110
Tru1I TTAA 1 cut(s) 155
Tru9I TTAA 1 cut(s) 155
XapI RAATTY 1 cut(s) 151
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.