pycom12g03780

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr12
OG0001246
Physical Location & Seq
Forward (+)
3670190 .. 3670884
695 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom12g03780.3

Sequence Viewer

Length: 366 bp
ATGGTGGGTGGCTTTGCTTTGCAGAAGGTTACCAACGAAAGAAGTTACTTTCGGACAATATCAAGTACGGATATAAAGATGGATTTCATCCCACCATCCCTTATAAATTTTATCTCGAGGCAGCTCATTGGCAATGGTCTCAAACTCTACCAAAAGGTAGTGTCTTCTAAGCTTAACTGCAATGAAGATTACAGTAAGGCCTTGAGTGGCCCGCTGTACTCTCATATACGTGAAGCTCTTTTTTCACATAATAAATCAAATGGGGCTTTGGAAGAAAAGAAGCTACATAATGATACATTCAGGCTCTCGGAAGAACATCTGGTAAAAGATAAGACGGATGAGAGTTTGGTAGATGTGGATCGATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

122

Amino Acids

13.78

Weight (kDa)

7.86

Isoelectric Point (pI)

30.5

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 104
AciI CCGC 1 cut(s) 212
AcsI RAATTY 1 cut(s) 106
AfaI GTAC 2 cut(s) 67, 218
AluBI AGCT 4 cut(s) 124, 172, 236, 283
AluI AGCT 4 cut(s) 124, 172, 236, 283
Alw26I GTCTC 1 cut(s) 143
Ama87I CYCGRG 1 cut(s) 115
AoxI GGCC 2 cut(s) 198, 208
ApeKI GCWGC 1 cut(s) 121
ApoI RAATTY 1 cut(s) 106
AspS9I GGNCC 1 cut(s) 209
AvaI CYCGRG 1 cut(s) 115
BbsI GAAGAC 1 cut(s) 156
BbvI GCAGC 1 cut(s) 133
BccI CCATC 2 cut(s) 73, 103
BcoDI GTCTC 1 cut(s) 143
BisI GCNGC 1 cut(s) 122
BlsI GCNGC 1 cut(s) 123
BmeT110I CYCGRG 1 cut(s) 115
BmgT120I GGNCC 1 cut(s) 209
BpiI GAAGAC 1 cut(s) 156
BpuEI CTTGAG 1 cut(s) 223
Bsa29I ATCGAT 1 cut(s) 361
BsaAI YACGTR 1 cut(s) 230
BsaBI GATNNNNATC 1 cut(s) 357
BsaI GGTCTC 1 cut(s) 143
Bse3DI GCAATG 2 cut(s) 139, 187
Bse8I GATNNNNATC 1 cut(s) 357
BseCI ATCGAT 1 cut(s) 361
BseGI GGATG 3 cut(s) 87, 95, 343
BseJI GATNNNNATC 1 cut(s) 357
BseMI GCAATG 2 cut(s) 139, 187
BseXI GCAGC 1 cut(s) 133
BshFI GGCC 2 cut(s) 200, 210
BshVI ATCGAT 1 cut(s) 361
BsiHKCI CYCGRG 1 cut(s) 115
BsmAI GTCTC 1 cut(s) 143
BsnI GGCC 2 cut(s) 200, 210
Bso31I GGTCTC 1 cut(s) 143
BsoBI CYCGRG 1 cut(s) 115
Bsp143I GATC 1 cut(s) 358
BspACI CCGC 1 cut(s) 212
BspANI GGCC 2 cut(s) 200, 210
BspDI ATCGAT 1 cut(s) 361
BspTNI GGTCTC 1 cut(s) 143
BsrDI GCAATG 2 cut(s) 139, 187
BssMI GATC 1 cut(s) 358
Bst4CI ACNGT 1 cut(s) 194
BstBAI YACGTR 1 cut(s) 230
BstC8I GCNNGC 1 cut(s) 212
BstDEI CTNAG 1 cut(s) 168
BstEII GGTNACC 1 cut(s) 28
BstF5I GGATG 3 cut(s) 87, 95, 343
BstKTI GATC 1 cut(s) 361
BstMAI GTCTC 1 cut(s) 143
BstMBI GATC 1 cut(s) 358
BstPI GGTNACC 1 cut(s) 28
BstV1I GCAGC 1 cut(s) 133
BstV2I GAAGAC 1 cut(s) 156
Bsu15I ATCGAT 1 cut(s) 361
BsuRI GGCC 2 cut(s) 200, 210
BsuTUI ATCGAT 1 cut(s) 361
BtsCI GGATG 3 cut(s) 87, 95, 343
Cac8I GCNNGC 1 cut(s) 212
Cfr13I GGNCC 1 cut(s) 209
ClaI ATCGAT 1 cut(s) 361
Csp6I GTAC 2 cut(s) 66, 217
CviJI RGCY 9 cut(s) 12, 124, 172, 200, 210, 236, 266, 283, 304
CviKI_1 RGCY 9 cut(s) 12, 124, 172, 200, 210, 236, 266, 283, 304
CviQI GTAC 2 cut(s) 66, 217
DdeI CTNAG 1 cut(s) 168
DpnI GATC 1 cut(s) 360
DpnII GATC 1 cut(s) 358
Eco147I AGGCCT 1 cut(s) 200
Eco31I GGTCTC 1 cut(s) 143
Eco88I CYCGRG 1 cut(s) 115
Eco91I GGTNACC 1 cut(s) 28
EcoO65I GGTNACC 1 cut(s) 28
FaiI YATR 6 cut(s) 74, 104, 225, 227, 249, 288
FauI CCCGC 1 cut(s) 219
Fnu4HI GCNGC 1 cut(s) 122
FokI GGATG 3 cut(s) 74, 82, 350
Fsp4HI GCNGC 1 cut(s) 122
GluI GCNGC 1 cut(s) 122
HaeIII GGCC 2 cut(s) 200, 210
HindIII AAGCTT 1 cut(s) 170
Hpy188I TCNGA 2 cut(s) 54, 310
Hpy188III TCNNGA 1 cut(s) 115
HpyAV CCTTC 1 cut(s) 19
HpyCH4III ACNGT 1 cut(s) 194
HpyCH4IV ACGT 1 cut(s) 229
HpyCH4V TGCA 2 cut(s) 22, 180
HpyF3I CTNAG 1 cut(s) 168
HpySE526I ACGT 1 cut(s) 229
Kzo9I GATC 1 cut(s) 358
LpnPI CCDG 2 cut(s) 286, 305
Lsp1109I GCAGC 1 cut(s) 133
MaeII ACGT 1 cut(s) 229
MaeIII GTNAC 2 cut(s) 28, 44
MalI GATC 1 cut(s) 360
MboI GATC 1 cut(s) 358
MboII GAAGA 4 cut(s) 156, 197, 284, 323
MluCI AATT 1 cut(s) 106
MnlI CCTC 1 cut(s) 111
MseI TTAA 1 cut(s) 174
MslI CAYNNNNRTG 1 cut(s) 228
MspA1I CMGCKG 1 cut(s) 214
NdeII GATC 1 cut(s) 358
PaeR7I CTCGAG 1 cut(s) 115
PceI AGGCCT 1 cut(s) 200
PkrI GCNGC 1 cut(s) 123
Ppu21I YACGTR 1 cut(s) 230
PsiI TTATAA 1 cut(s) 104
PspEI GGTNACC 1 cut(s) 28
PspPI GGNCC 1 cut(s) 209
RsaI GTAC 2 cut(s) 67, 218
RsaNI GTAC 2 cut(s) 66, 217
RseI CAYNNNNRTG 1 cut(s) 228
SaqAI TTAA 1 cut(s) 174
SatI GCNGC 1 cut(s) 122
Sau3AI GATC 1 cut(s) 358
Sau96I GGNCC 1 cut(s) 209
SetI ASST 7 cut(s) 30, 126, 159, 174, 232, 238, 285
Sfr274I CTCGAG 1 cut(s) 115
SgeI CNNG 9 cut(s) 75, 127, 129, 214, 223, 242, 313, 319, 332
SlaI CTCGAG 1 cut(s) 115
SmiMI CAYNNNNRTG 1 cut(s) 228
SmlI CTYRAG 2 cut(s) 115, 202
SmoI CTYRAG 2 cut(s) 115, 202
Sse9I AATT 1 cut(s) 106
SseBI AGGCCT 1 cut(s) 200
SsiI CCGC 1 cut(s) 212
StuI AGGCCT 1 cut(s) 200
TaaI ACNGT 1 cut(s) 194
TaiI ACGT 1 cut(s) 232
TaqI TCGA 2 cut(s) 116, 361
TasI AATT 1 cut(s) 106
TatI WGTACW 1 cut(s) 216
Tru1I TTAA 1 cut(s) 174
Tru9I TTAA 1 cut(s) 174
TseI GCWGC 1 cut(s) 121
TspDTI ATGAA 2 cut(s) 76, 198
TspGWI ACGGA 2 cut(s) 83, 350
XapI RAATTY 1 cut(s) 106
XhoI CTCGAG 1 cut(s) 115
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.