Rmu_sc0027136.1_g000001

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0027136.1
OG0001246
Physical Location & Seq
Reverse (-)
1 .. 876
876 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0027136.1_g000001.1.cds

Sequence Viewer

Length: 413 bp
atgtttcattctcttcagtgcagtatgtgtatactacttattcaggcatgtgcatttgaatgctctgatgctatgcttaggcagtggaccgtgtggcctcagtctaccattccaacttttaaaattctctatgggaagtgtttacagaaggtcgggattggcgaacagatatctgtagtgaggatgaagattccgtggccactttcacctagggaagctgttgtgcactattttgtgtttgagtactatgaagatgacctggttgttgttctcttgaacacgatctctgattttggaggcattgatggtggccttaaaaatgaggcaactgatggagtaaaggatgcagttaggatagatgtagttggtggctttgctttgcagaaggttactgatgatagaagttactttcg
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

138

Amino Acids

15.6

Weight (kDa)

5.28

Isoelectric Point (pI)

37.47

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 2 cut(s) 31, 104
AcoI YGGCCR 1 cut(s) 197
AcsI RAATTY 1 cut(s) 123
AfaI GTAC 1 cut(s) 245
AgsI TTSAA 2 cut(s) 59, 277
AjnI CCWGG 1 cut(s) 258
AluBI AGCT 1 cut(s) 218
AluI AGCT 1 cut(s) 218
Alw21I GWGCWC 1 cut(s) 228
Alw44I GTGCAC 1 cut(s) 224
AoxI GGCC 3 cut(s) 95, 197, 310
ApaLI GTGCAC 1 cut(s) 224
ApoI RAATTY 1 cut(s) 123
AspA2I CCTAGG 1 cut(s) 209
AspS9I GGNCC 1 cut(s) 87
AsuHPI GGTGA 1 cut(s) 198
AvaII GGWCC 1 cut(s) 87
AvrII CCTAGG 1 cut(s) 209
BaeGI GKGCMC 1 cut(s) 228
BalI TGGCCA 1 cut(s) 199
Bbv12I GWGCWC 1 cut(s) 228
BccI CCATC 2 cut(s) 299, 326
BciT130I CCWGG 1 cut(s) 260
BfaI CTAG 1 cut(s) 210
BfmI CTRYAG 1 cut(s) 174
BlnI CCTAGG 1 cut(s) 209
BmcAI AGTACT 1 cut(s) 245
Bme1390I CCNGG 1 cut(s) 260
Bme18I GGWCC 1 cut(s) 87
BmgT120I GGNCC 1 cut(s) 87
BmrFI CCNGG 1 cut(s) 260
BmsI GCATC 2 cut(s) 58, 334
Bpu10I CCTNAGC 1 cut(s) 77
BsaJI CCNNGG 2 cut(s) 194, 209
BseBI CCWGG 1 cut(s) 260
BseDI CCNNGG 2 cut(s) 194, 209
BseGI GGATG 2 cut(s) 189, 349
BseMII CTCAG 1 cut(s) 113
BseSI GKGCMC 1 cut(s) 228
BsgI GTGCAG 1 cut(s) 40
BshFI GGCC 3 cut(s) 97, 199, 312
BsiHKAI GWGCWC 1 cut(s) 228
BsmI GAATGC 1 cut(s) 65
BsnI GGCC 3 cut(s) 97, 199, 312
Bsp1286I GDGCHC 1 cut(s) 228
Bsp143I GATC 1 cut(s) 282
BspANI GGCC 3 cut(s) 97, 199, 312
BspCNI CTCAG 1 cut(s) 112
BssECI CCNNGG 2 cut(s) 194, 209
BssMI GATC 1 cut(s) 282
BssNAI GTATAC 1 cut(s) 32
BssT1I CCWWGG 1 cut(s) 209
Bst1107I GTATAC 1 cut(s) 32
Bst2UI CCWGG 1 cut(s) 260
Bst4CI ACNGT 1 cut(s) 91
Bst6I CTCTTC 1 cut(s) 18
BstDEI CTNAG 2 cut(s) 77, 99
BstDSI CCRYGG 1 cut(s) 194
BstF5I GGATG 2 cut(s) 189, 349
BstKTI GATC 1 cut(s) 285
BstMBI GATC 1 cut(s) 282
BstNI CCWGG 1 cut(s) 260
BstNSI RCATGY 1 cut(s) 51
BstSCI CCNGG 1 cut(s) 258
BstSFI CTRYAG 1 cut(s) 174
BstSLI GKGCMC 1 cut(s) 228
BstZ17I GTATAC 1 cut(s) 32
BsuRI GGCC 3 cut(s) 97, 199, 312
BtgI CCRYGG 1 cut(s) 194
BtsCI GGATG 2 cut(s) 189, 349
BtsI GCAGTG 1 cut(s) 89
BtsIMutI CAGTG 2 cut(s) 23, 89
Cfr13I GGNCC 1 cut(s) 87
CsiI ACCWGGT 1 cut(s) 258
Csp6I GTAC 1 cut(s) 244
CviAII CATG 1 cut(s) 48
CviJI RGCY 5 cut(s) 97, 199, 218, 312, 372
CviKI_1 RGCY 5 cut(s) 97, 199, 218, 312, 372
CviQI GTAC 1 cut(s) 244
DdeI CTNAG 2 cut(s) 77, 99
DpnI GATC 1 cut(s) 284
DpnII GATC 1 cut(s) 282
DraI TTTAAA 1 cut(s) 121
EaeI YGGCCR 1 cut(s) 197
Eam1104I CTCTTC 1 cut(s) 18
EarI CTCTTC 1 cut(s) 18
Eco130I CCWWGG 1 cut(s) 209
Eco32I GATATC 1 cut(s) 171
Eco47I GGWCC 1 cut(s) 87
EcoRII CCWGG 1 cut(s) 258
EcoRV GATATC 1 cut(s) 171
EcoT14I CCWWGG 1 cut(s) 209
ErhI CCWWGG 1 cut(s) 209
FaeI CATG 1 cut(s) 51
FaiI YATR 6 cut(s) 26, 32, 49, 74, 132, 249
FatI CATG 1 cut(s) 47
FblI GTMKAC 2 cut(s) 31, 104
FokI GGATG 2 cut(s) 196, 356
FspBI CTAG 1 cut(s) 210
HaeIII GGCC 3 cut(s) 97, 199, 312
Hin1II CATG 1 cut(s) 51
HinfI GANTC 1 cut(s) 190
HphI GGTGA 1 cut(s) 198
Hpy166II GTNNAC 5 cut(s) 32, 87, 105, 143, 226
Hpy188I TCNGA 2 cut(s) 67, 289
Hpy188III TCNNGA 2 cut(s) 154, 274
Hpy8I GTNNAC 5 cut(s) 32, 87, 105, 143, 226
HpyAV CCTTC 2 cut(s) 142, 379
HpyCH4III ACNGT 1 cut(s) 91
HpyCH4V TGCA 5 cut(s) 21, 53, 226, 347, 382
HpyF3I CTNAG 2 cut(s) 77, 99
Hsp92II CATG 1 cut(s) 51
Kzo9I GATC 1 cut(s) 282
LpnPI CCDG 3 cut(s) 29, 245, 272
LweI GCATC 2 cut(s) 58, 334
MabI ACCWGGT 1 cut(s) 258
MaeI CTAG 1 cut(s) 210
MaeIII GTNAC 2 cut(s) 388, 404
MalI GATC 1 cut(s) 284
MboI GATC 1 cut(s) 282
MboII GAAGA 3 cut(s) 5, 199, 263
MhlI GDGCHC 1 cut(s) 228
MlsI TGGCCA 1 cut(s) 199
MluCI AATT 1 cut(s) 123
MluNI TGGCCA 1 cut(s) 199
MmeI TCCRAC 1 cut(s) 137
MnlI CCTC 4 cut(s) 108, 174, 290, 316
Mox20I TGGCCA 1 cut(s) 199
MscI TGGCCA 1 cut(s) 199
MseI TTAA 2 cut(s) 120, 315
MslI CAYNNNNRTG 1 cut(s) 58
Msp20I TGGCCA 1 cut(s) 199
MspR9I CCNGG 1 cut(s) 260
Mva1269I GAATGC 1 cut(s) 65
MvaI CCWGG 1 cut(s) 260
NdeII GATC 1 cut(s) 282
NlaIII CATG 1 cut(s) 51
NspI RCATGY 1 cut(s) 51
PcsI WCGNNNNNNNCGW 1 cut(s) 159
PctI GAATGC 1 cut(s) 65
PfeI GAWTC 1 cut(s) 190
Psp6I CCWGG 1 cut(s) 258
PspGI CCWGG 1 cut(s) 258
PspPI GGNCC 1 cut(s) 87
RsaI GTAC 1 cut(s) 245
RsaNI GTAC 1 cut(s) 244
RseI CAYNNNNRTG 1 cut(s) 58
SaqAI TTAA 2 cut(s) 120, 315
Sau3AI GATC 1 cut(s) 282
Sau96I GGNCC 1 cut(s) 87
ScaI AGTACT 1 cut(s) 245
ScrFI CCNGG 1 cut(s) 260
SduI GDGCHC 1 cut(s) 228
SetI ASST 5 cut(s) 153, 211, 220, 261, 390
SexAI ACCWGGT 1 cut(s) 258
SfaNI GCATC 2 cut(s) 58, 334
SfcI CTRYAG 1 cut(s) 174
SinI GGWCC 1 cut(s) 87
SmiMI CAYNNNNRTG 1 cut(s) 58
Sse9I AATT 1 cut(s) 123
SspMI CTAG 1 cut(s) 210
StyD4I CCNGG 1 cut(s) 258
StyI CCWWGG 1 cut(s) 209
TaaI ACNGT 1 cut(s) 91
TasI AATT 1 cut(s) 123
TatI WGTACW 1 cut(s) 243
TfiI GAWTC 1 cut(s) 190
Tru1I TTAA 2 cut(s) 120, 315
Tru9I TTAA 2 cut(s) 120, 315
TscAI CASTG 2 cut(s) 23, 89
TspDTI ATGAA 2 cut(s) 200, 264
TspGWI ACGGA 1 cut(s) 183
TspRI CASTG 2 cut(s) 23, 89
VneI GTGCAC 1 cut(s) 224
VpaK11BI GGWCC 1 cut(s) 87
XapI RAATTY 1 cut(s) 123
XceI RCATGY 1 cut(s) 51
XmaJI CCTAGG 1 cut(s) 209
XmiI GTMKAC 2 cut(s) 31, 104
XspI CTAG 1 cut(s) 210
ZrmI AGTACT 1 cut(s) 245
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.