pycom17g09560

Regulatory subunit of the condensin complex, a complex required for conversion of interphase chromatin into mitotic-like condense chromosomes

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr17
Physical Location & Seq
Reverse (-)
7280933 .. 7281213
281 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom17g09560.2

Sequence Viewer

Length: 207 bp
ATGGTATTGAACATGCGAATCAAAGATGAAATTTCACCAACTCTTAGGAATGCTGCCTATAACAATGAAGCTGATTTTGATTGTGATGCATTTGAGAATTGCGGGAACTGGAATTATGATCATGATGACCAAACAAACGTCGTGGAGGAGGGCCTTAACTGTGAATATTTATCCAACACATCTCTCTCTAAGCTTACAGCATTGTAA

Protein Analysis

69

Amino Acids

7.75

Weight (kDa)

4.05

Isoelectric Point (pI)

25.49

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 102
AcsI RAATTY 1 cut(s) 30
AgsI TTSAA 1 cut(s) 10
AluBI AGCT 2 cut(s) 71, 193
AluI AGCT 2 cut(s) 71, 193
AoxI GGCC 1 cut(s) 151
ApeKI GCWGC 1 cut(s) 53
ApoI RAATTY 1 cut(s) 30
AspS9I GGNCC 1 cut(s) 151
AsuHPI GGTGA 1 cut(s) 27
BbvI GCAGC 1 cut(s) 40
BclI TGATCA 1 cut(s) 118
BisI GCNGC 1 cut(s) 54
BlsI GCNGC 1 cut(s) 55
BmgT120I GGNCC 1 cut(s) 151
BmsI GCATC 1 cut(s) 76
Bse1I ACTGG 1 cut(s) 113
BseNI ACTGG 1 cut(s) 113
BseRI GAGGAG 1 cut(s) 161
BseXI GCAGC 1 cut(s) 40
BshFI GGCC 1 cut(s) 153
BsmI GAATGC 1 cut(s) 55
BsnI GGCC 1 cut(s) 153
Bsp143I GATC 1 cut(s) 118
BspACI CCGC 1 cut(s) 102
BspANI GGCC 1 cut(s) 153
BspHI TCATGA 1 cut(s) 121
BsrI ACTGG 1 cut(s) 113
BssMI GATC 1 cut(s) 118
Bst4CI ACNGT 1 cut(s) 161
BstDEI CTNAG 2 cut(s) 44, 189
BstKTI GATC 1 cut(s) 121
BstMBI GATC 1 cut(s) 118
BstNSI RCATGY 1 cut(s) 16
BstV1I GCAGC 1 cut(s) 40
BsuRI GGCC 1 cut(s) 153
CciI TCATGA 1 cut(s) 121
Cfr13I GGNCC 1 cut(s) 151
CspCI CAANNNNNGTGG 2 cut(s) 123, 158
CviAII CATG 2 cut(s) 13, 122
CviJI RGCY 3 cut(s) 71, 153, 193
CviKI_1 RGCY 3 cut(s) 71, 153, 193
DdeI CTNAG 2 cut(s) 44, 189
DpnI GATC 1 cut(s) 120
DpnII GATC 1 cut(s) 118
EcoO109I RGGNCCY 1 cut(s) 151
EcoT22I ATGCAT 1 cut(s) 91
FaeI CATG 2 cut(s) 16, 125
FaiI YATR 4 cut(s) 14, 60, 117, 123
FatI CATG 2 cut(s) 12, 121
FauI CCCGC 1 cut(s) 95
FbaI TGATCA 1 cut(s) 118
Fnu4HI GCNGC 1 cut(s) 54
Fsp4HI GCNGC 1 cut(s) 54
GluI GCNGC 1 cut(s) 54
HaeIII GGCC 1 cut(s) 153
Hin1II CATG 2 cut(s) 16, 125
HindIII AAGCTT 1 cut(s) 191
HinfI GANTC 1 cut(s) 18
HphI GGTGA 1 cut(s) 27
Hpy188III TCNNGA 1 cut(s) 122
Hpy99I CGWCG 1 cut(s) 143
HpyCH4III ACNGT 1 cut(s) 161
HpyCH4IV ACGT 1 cut(s) 138
HpyCH4V TGCA 1 cut(s) 89
HpyF3I CTNAG 2 cut(s) 44, 189
HpySE526I ACGT 1 cut(s) 138
Hsp92II CATG 2 cut(s) 16, 125
Ksp22I TGATCA 1 cut(s) 118
Kzo9I GATC 1 cut(s) 118
LpnPI CCDG 1 cut(s) 94
Lsp1109I GCAGC 1 cut(s) 40
LweI GCATC 1 cut(s) 76
MaeII ACGT 1 cut(s) 138
MalI GATC 1 cut(s) 120
MboI GATC 1 cut(s) 118
MluCI AATT 3 cut(s) 30, 97, 112
MmeI TCCRAC 1 cut(s) 198
MnlI CCTC 2 cut(s) 139, 142
Mph1103I ATGCAT 1 cut(s) 91
MseI TTAA 1 cut(s) 156
Mva1269I GAATGC 1 cut(s) 55
NdeII GATC 1 cut(s) 118
NlaIII CATG 2 cut(s) 16, 125
NsiI ATGCAT 1 cut(s) 91
NspI RCATGY 1 cut(s) 16
PagI TCATGA 1 cut(s) 121
PctI GAATGC 1 cut(s) 55
PfeI GAWTC 1 cut(s) 18
PkrI GCNGC 1 cut(s) 55
PspPI GGNCC 1 cut(s) 151
SaqAI TTAA 1 cut(s) 156
SatI GCNGC 1 cut(s) 54
Sau3AI GATC 1 cut(s) 118
Sau96I GGNCC 1 cut(s) 151
SetI ASST 3 cut(s) 73, 141, 195
SfaNI GCATC 1 cut(s) 76
SgeI CNNG 5 cut(s) 25, 115, 121, 134, 154
Sse9I AATT 3 cut(s) 30, 97, 112
SsiI CCGC 1 cut(s) 102
SspI AATATT 1 cut(s) 167
TaaI ACNGT 1 cut(s) 161
TaiI ACGT 1 cut(s) 141
TasI AATT 3 cut(s) 30, 97, 112
TfiI GAWTC 1 cut(s) 18
Tru1I TTAA 1 cut(s) 156
Tru9I TTAA 1 cut(s) 156
TseI GCWGC 1 cut(s) 53
TspDTI ATGAA 2 cut(s) 42, 81
XapI RAATTY 1 cut(s) 30
XceI RCATGY 1 cut(s) 16
Zsp2I ATGCAT 1 cut(s) 91
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.