Rmu_co8379437.1_g000001

Regulatory subunit of the condensin complex, a complex required for conversion of interphase chromatin into mitotic-like condense chromosomes

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8379437.1
Physical Location & Seq
Forward (+)
1 .. 1128
1128 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8379437.1_g000001.1.cds

Sequence Viewer

Length: 725 bp
cagtgcacgctgaagcgtataaagttctgggtaggatcaatcgagctggtcttgaagatggacaagagactactatggaggatggcaatgtcagtgatgggaaggataagagtcagtgtaagaaagaggtggagcggaaggtatcaccactatcgacattggaatcgtcctttgaagctctaaacttgaagaagtttgatgttgcattcgtggtagatcccctgtatcatcagacatctgcacagtttgatgatggcggagccaagggtctgctattgaataatcttggagtatatggaaggtgccaggtgctttttgattcttcagaagttccagggaagtgcagatcatgtcaattgaaaaataaagccttggatttgatagatttatcttttgagaaagaatcaattcagcagatggtgactaacatgcttggaaaaaatgaaatttctcctactctaaatgatatactatgccatattgataaagataatcgacgatcagcacaagcttttaatataacccagaatccagatcttcctgcagatgcatttgatgataacgaagttgggttagacttttcatctgggagatatgacacggcgaccattgaacatgaacgtgatgatgatatatatgtcagtcatgaggatgtaaattttggaacatttcaaaatcatcaggaggtattttatatagctatgctgaattcatttagaccttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

240

Amino Acids

26.89

Weight (kDa)

4.72

Isoelectric Point (pI)

38.76

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 302
AccBSI CCGCTC 1 cut(s) 135
AciI CCGC 2 cut(s) 135, 257
AclWI GGATC 2 cut(s) 43, 211
AcsI RAATTY 3 cut(s) 446, 657, 708
AcuI CTGAAG 2 cut(s) 32, 308
AgsI TTSAA 7 cut(s) 55, 175, 189, 279, 360, 613, 673
AjnI CCWGG 2 cut(s) 305, 333
AluBI AGCT 4 cut(s) 46, 178, 511, 700
AluI AGCT 4 cut(s) 46, 178, 511, 700
Alw21I GWGCWC 1 cut(s) 8
Alw26I GTCTC 1 cut(s) 61
Alw44I GTGCAC 1 cut(s) 4
AlwI GGATC 2 cut(s) 43, 211
ApaLI GTGCAC 1 cut(s) 4
ApoI RAATTY 3 cut(s) 446, 657, 708
Asp700I GAANNNNTTC 1 cut(s) 407
AsuHPI GGTGA 2 cut(s) 137, 432
BaeGI GKGCMC 1 cut(s) 8
BanI GGYRCC 1 cut(s) 302
Bbv12I GWGCWC 1 cut(s) 8
BccI CCATC 5 cut(s) 52, 76, 91, 247, 411
BceAI ACGGC 1 cut(s) 617
BciT130I CCWGG 2 cut(s) 307, 335
BcoDI GTCTC 1 cut(s) 61
BfmI CTRYAG 1 cut(s) 542
BglII AGATCT 1 cut(s) 534
Bme1390I CCNGG 2 cut(s) 307, 335
BmiI GGNNCC 2 cut(s) 261, 304
BmrFI CCNGG 2 cut(s) 307, 335
BmsI GCATC 1 cut(s) 537
BsaJI CCNNGG 3 cut(s) 263, 334, 371
Bse3DI GCAATG 1 cut(s) 93
BseBI CCWGG 2 cut(s) 307, 335
BseDI CCNNGG 3 cut(s) 263, 334, 371
BseGI GGATG 2 cut(s) 87, 657
BseMI GCAATG 1 cut(s) 93
BseSI GKGCMC 1 cut(s) 8
BsgI GTGCAG 2 cut(s) 224, 363
BshNI GGYRCC 1 cut(s) 302
BsiHKAI GWGCWC 1 cut(s) 8
BsmAI GTCTC 1 cut(s) 61
BsmI GAATGC 1 cut(s) 205
Bsp1286I GDGCHC 1 cut(s) 8
Bsp143I GATC 5 cut(s) 35, 216, 346, 499, 534
BspACI CCGC 2 cut(s) 135, 257
BspHI TCATGA 1 cut(s) 645
BspLI GGNNCC 2 cut(s) 261, 304
BspMAI CTGCAG 1 cut(s) 546
BspPI GGATC 2 cut(s) 43, 211
BspT107I GGYRCC 1 cut(s) 302
BsrBI CCGCTC 1 cut(s) 135
BsrDI GCAATG 1 cut(s) 93
BssECI CCNNGG 3 cut(s) 263, 334, 371
BssMI GATC 5 cut(s) 35, 216, 346, 499, 534
BssT1I CCWWGG 2 cut(s) 263, 371
Bst2UI CCWGG 2 cut(s) 307, 335
Bst4CI ACNGT 1 cut(s) 245
BstC8I GCNNGC 1 cut(s) 8
BstF5I GGATG 2 cut(s) 87, 657
BstKTI GATC 5 cut(s) 38, 219, 349, 502, 537
BstMAI GTCTC 1 cut(s) 61
BstMBI GATC 5 cut(s) 35, 216, 346, 499, 534
BstNI CCWGG 2 cut(s) 307, 335
BstNSI RCATGY 1 cut(s) 432
BstSCI CCNGG 2 cut(s) 305, 333
BstSFI CTRYAG 1 cut(s) 542
BstSLI GKGCMC 1 cut(s) 8
BstX2I RGATCY 2 cut(s) 216, 534
BstYI RGATCY 2 cut(s) 216, 534
BtsCI GGATG 2 cut(s) 87, 657
BtsIMutI CAGTG 3 cut(s) 8, 99, 121
Cac8I GCNNGC 1 cut(s) 8
CciI TCATGA 1 cut(s) 645
CviAII CATG 4 cut(s) 350, 429, 616, 646
CviJI RGCY 6 cut(s) 46, 178, 262, 370, 511, 700
CviKI_1 RGCY 6 cut(s) 46, 178, 262, 370, 511, 700
DpnI GATC 5 cut(s) 37, 218, 348, 501, 536
DpnII GATC 5 cut(s) 35, 216, 346, 499, 534
EciI GGCGGA 1 cut(s) 272
Eco130I CCWWGG 2 cut(s) 263, 371
Eco57I CTGAAG 2 cut(s) 32, 308
EcoRI GAATTC 1 cut(s) 708
EcoRII CCWGG 2 cut(s) 305, 333
EcoT14I CCWWGG 2 cut(s) 263, 371
EcoT22I ATGCAT 1 cut(s) 552
ErhI CCWWGG 2 cut(s) 263, 371
FaeI CATG 4 cut(s) 353, 432, 619, 649
FatI CATG 4 cut(s) 349, 428, 615, 645
FokI GGATG 2 cut(s) 94, 664
Hin1II CATG 4 cut(s) 353, 432, 619, 649
HindIII AAGCTT 1 cut(s) 509
HinfI GANTC 5 cut(s) 111, 163, 319, 403, 528
HphI GGTGA 2 cut(s) 137, 432
Hpy166II GTNNAC 1 cut(s) 6
Hpy188I TCNGA 2 cut(s) 233, 327
Hpy188III TCNNGA 4 cut(s) 52, 532, 646, 682
Hpy8I GTNNAC 1 cut(s) 6
Hpy99I CGWCG 1 cut(s) 500
HpyAV CCTTC 3 cut(s) 96, 132, 293
HpyCH4III ACNGT 1 cut(s) 245
HpyCH4IV ACGT 1 cut(s) 621
HpyCH4V TGCA 6 cut(s) 6, 205, 241, 344, 544, 550
HpySE526I ACGT 1 cut(s) 621
Hsp92II CATG 4 cut(s) 353, 432, 619, 649
Kzo9I GATC 5 cut(s) 35, 216, 346, 499, 534
LmnI GCTCC 2 cut(s) 132, 259
LweI GCATC 1 cut(s) 537
MaeII ACGT 1 cut(s) 621
MaeIII GTNAC 1 cut(s) 420
MalI GATC 5 cut(s) 37, 218, 348, 501, 536
MbiI CCGCTC 1 cut(s) 135
MboI GATC 5 cut(s) 35, 216, 346, 499, 534
MboII GAAGA 4 cut(s) 67, 201, 314, 529
MfeI CAATTG 1 cut(s) 355
MflI RGATCY 2 cut(s) 216, 534
MhlI GDGCHC 1 cut(s) 8
MluCI AATT 5 cut(s) 355, 407, 446, 657, 708
MlyI GAGTC 1 cut(s) 120
MnlI CCTC 4 cut(s) 72, 120, 642, 678
Mph1103I ATGCAT 1 cut(s) 552
MroXI GAANNNNTTC 1 cut(s) 407
MseI TTAA 1 cut(s) 515
MslI CAYNNNNRTG 2 cut(s) 620, 650
MspR9I CCNGG 2 cut(s) 307, 335
MunI CAATTG 1 cut(s) 355
Mva1269I GAATGC 1 cut(s) 205
MvaI CCWGG 2 cut(s) 307, 335
NdeII GATC 5 cut(s) 35, 216, 346, 499, 534
NlaIII CATG 4 cut(s) 353, 432, 619, 649
NlaIV GGNNCC 2 cut(s) 261, 304
NmuCI GTSAC 1 cut(s) 420
NsiI ATGCAT 1 cut(s) 552
NspI RCATGY 1 cut(s) 432
PagI TCATGA 1 cut(s) 645
PctI GAATGC 1 cut(s) 205
PdmI GAANNNNTTC 1 cut(s) 407
PfeI GAWTC 4 cut(s) 163, 319, 403, 528
PleI GAGTC 1 cut(s) 119
PpsI GAGTC 1 cut(s) 119
Psp6I CCWGG 2 cut(s) 305, 333
PspGI CCWGG 2 cut(s) 305, 333
PspN4I GGNNCC 2 cut(s) 261, 304
PstI CTGCAG 1 cut(s) 546
PsuI RGATCY 2 cut(s) 216, 534
RseI CAYNNNNRTG 2 cut(s) 620, 650
SaqAI TTAA 1 cut(s) 515
Sau3AI GATC 5 cut(s) 35, 216, 346, 499, 534
SchI GAGTC 1 cut(s) 120
ScrFI CCNGG 2 cut(s) 307, 335
SduI GDGCHC 1 cut(s) 8
SfaNI GCATC 1 cut(s) 537
SfcI CTRYAG 1 cut(s) 542
SmiMI CAYNNNNRTG 2 cut(s) 620, 650
Sse9I AATT 5 cut(s) 355, 407, 446, 657, 708
SsiI CCGC 2 cut(s) 135, 257
StyD4I CCNGG 2 cut(s) 305, 333
StyI CCWWGG 2 cut(s) 263, 371
TaaI ACNGT 1 cut(s) 245
TaiI ACGT 1 cut(s) 624
TaqI TCGA 3 cut(s) 42, 154, 495
TasI AATT 5 cut(s) 355, 407, 446, 657, 708
TfiI GAWTC 4 cut(s) 163, 319, 403, 528
Tru1I TTAA 1 cut(s) 515
Tru9I TTAA 1 cut(s) 515
TscAI CASTG 2 cut(s) 99, 121
TseFI GTSAC 1 cut(s) 420
Tsp45I GTSAC 1 cut(s) 420
TspDTI ATGAA 4 cut(s) 458, 572, 632, 701
TspRI CASTG 2 cut(s) 99, 121
VneI GTGCAC 1 cut(s) 4
XapI RAATTY 3 cut(s) 446, 657, 708
XceI RCATGY 1 cut(s) 432
XmnI GAANNNNTTC 1 cut(s) 407
Zsp2I ATGCAT 1 cut(s) 552
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.