Rmu_sc0040010.1_g000001

Regulatory subunit of the condensin complex, a complex required for conversion of interphase chromatin into mitotic-like condense chromosomes

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0040010.1
Physical Location & Seq
Forward (+)
1 .. 815
815 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0040010.1_g000001.1.cds

Sequence Viewer

Length: 502 bp
aagcatggtggaggaggaacataactacgaaaatacaagtttccctagttatcatgaggaaaatgaaccaagttctttccatgaacctgattttgatgacagacttgagaaagttgatggctttttgtttttaagtcttggattcacttcaaaacaaaatgcttgggcaggtcctgatcattggaagtaccaaaaaactaaaggttccgaggtgaatcctcctgcagaaccaccattaacaattaagcgacaaagaagcaaacaacagcctgatattgatttcacaaaagccttggaagaagaaatgtcagatctatttgctccccccaaaaaccccaagtcgttgctgctgcctgcaaatagagcaagttgcagtacgaaacttcctgaggattgccactatcaaccagaggatcttatcaagttattccttctacccaatgtaaagtgccttggaaggagagggaggaagtcctcaggtaacaaatctttttttggttga

Protein Analysis

166

Amino Acids

19.0

Weight (kDa)

5.76

Isoelectric Point (pI)

64.59

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 159
AclWI GGATC 1 cut(s) 421
AfaI GTAC 2 cut(s) 189, 377
AgsI TTSAA 1 cut(s) 151
AlwI GGATC 1 cut(s) 421
AlwNI CAGNNNCTG 1 cut(s) 174
ApeKI GCWGC 2 cut(s) 347, 350
AspS9I GGNCC 1 cut(s) 171
AsuHPI GGTGA 1 cut(s) 224
AvaII GGWCC 1 cut(s) 171
AxyI CCTNAGG 2 cut(s) 388, 476
BbvI GCAGC 2 cut(s) 334, 337
BccI CCATC 1 cut(s) 111
BclI TGATCA 1 cut(s) 176
BfaI CTAG 1 cut(s) 46
BfmI CTRYAG 1 cut(s) 223
BfuAI ACCTGC 1 cut(s) 159
BglII AGATCT 1 cut(s) 311
BisI GCNGC 2 cut(s) 348, 351
BlsI GCNGC 2 cut(s) 349, 352
Bme18I GGWCC 1 cut(s) 171
BmgT120I GGNCC 1 cut(s) 171
BmiI GGNNCC 1 cut(s) 206
BpuEI CTTGAG 1 cut(s) 126
BsaJI CCNNGG 3 cut(s) 208, 292, 452
Bse21I CCTNAGG 2 cut(s) 388, 476
BseDI CCNNGG 3 cut(s) 208, 292, 452
BseMII CTCAG 2 cut(s) 379, 490
BseRI GAGGAG 1 cut(s) 27
BseXI GCAGC 2 cut(s) 334, 337
Bsp143I GATC 3 cut(s) 176, 311, 413
BspCNI CTCAG 2 cut(s) 380, 489
BspHI TCATGA 1 cut(s) 53
BspLI GGNNCC 1 cut(s) 206
BspMAI CTGCAG 1 cut(s) 227
BspMI ACCTGC 1 cut(s) 159
BspPI GGATC 1 cut(s) 421
BssECI CCNNGG 3 cut(s) 208, 292, 452
BssMI GATC 3 cut(s) 176, 311, 413
BssT1I CCWWGG 2 cut(s) 292, 452
BstC8I GCNNGC 1 cut(s) 355
BstDEI CTNAG 2 cut(s) 388, 476
BstKTI GATC 3 cut(s) 179, 314, 416
BstMBI GATC 3 cut(s) 176, 311, 413
BstMWI GCNNNNNNNGC 1 cut(s) 363
BstSFI CTRYAG 1 cut(s) 223
BstV1I GCAGC 2 cut(s) 334, 337
BstX2I RGATCY 2 cut(s) 311, 413
BstYI RGATCY 2 cut(s) 311, 413
Bsu36I CCTNAGG 2 cut(s) 388, 476
BveI ACCTGC 1 cut(s) 159
Cac8I GCNNGC 1 cut(s) 355
CaiI CAGNNNCTG 1 cut(s) 174
CciI TCATGA 1 cut(s) 53
Cfr13I GGNCC 1 cut(s) 171
Csp6I GTAC 2 cut(s) 188, 376
CviAII CATG 3 cut(s) 5, 54, 81
CviJI RGCY 3 cut(s) 121, 269, 291
CviKI_1 RGCY 3 cut(s) 121, 269, 291
CviQI GTAC 2 cut(s) 188, 376
DdeI CTNAG 2 cut(s) 388, 476
DpnI GATC 3 cut(s) 178, 313, 415
DpnII GATC 3 cut(s) 176, 311, 413
Eco130I CCWWGG 2 cut(s) 292, 452
Eco47I GGWCC 1 cut(s) 171
Eco81I CCTNAGG 2 cut(s) 388, 476
EcoO109I RGGNCCY 1 cut(s) 171
EcoT14I CCWWGG 2 cut(s) 292, 452
ErhI CCWWGG 2 cut(s) 292, 452
FaeI CATG 3 cut(s) 8, 57, 84
FaiI YATR 4 cut(s) 6, 22, 55, 82
FatI CATG 3 cut(s) 4, 53, 80
FbaI TGATCA 1 cut(s) 176
Fnu4HI GCNGC 2 cut(s) 348, 351
Fsp4HI GCNGC 2 cut(s) 348, 351
FspBI CTAG 1 cut(s) 46
GluI GCNGC 2 cut(s) 348, 351
Hin1II CATG 3 cut(s) 8, 57, 84
HinfI GANTC 2 cut(s) 142, 215
HphI GGTGA 1 cut(s) 224
Hpy188I TCNGA 2 cut(s) 209, 311
Hpy188III TCNNGA 3 cut(s) 54, 174, 387
HpyAV CCTTC 2 cut(s) 441, 451
HpyCH4V TGCA 3 cut(s) 225, 357, 373
HpyF10VI GCNNNNNNNGC 1 cut(s) 363
HpyF3I CTNAG 2 cut(s) 388, 476
Hsp92II CATG 3 cut(s) 8, 57, 84
Ksp22I TGATCA 1 cut(s) 176
Kzo9I GATC 3 cut(s) 176, 311, 413
LmnI GCTCC 1 cut(s) 326
LpnPI CCDG 9 cut(s) 100, 154, 187, 235, 283, 367, 400, 421, 463
Lsp1109I GCAGC 2 cut(s) 334, 337
MaeI CTAG 1 cut(s) 46
MaeIII GTNAC 1 cut(s) 480
MalI GATC 3 cut(s) 178, 313, 415
MboI GATC 3 cut(s) 176, 311, 413
MboII GAAGA 2 cut(s) 309, 312
MflI RGATCY 2 cut(s) 311, 413
MluCI AATT 1 cut(s) 241
MseI TTAA 3 cut(s) 132, 237, 244
MwoI GCNNNNNNNGC 1 cut(s) 363
NdeII GATC 3 cut(s) 176, 311, 413
NlaIII CATG 3 cut(s) 8, 57, 84
NlaIV GGNNCC 1 cut(s) 206
PagI TCATGA 1 cut(s) 53
PfeI GAWTC 2 cut(s) 142, 215
PkrI GCNGC 2 cut(s) 349, 352
PpuMI RGGWCCY 1 cut(s) 171
Psp5II RGGWCCY 1 cut(s) 171
PspN4I GGNNCC 1 cut(s) 206
PspPI GGNCC 1 cut(s) 171
PspPPI RGGWCCY 1 cut(s) 171
PstI CTGCAG 1 cut(s) 227
PstNI CAGNNNCTG 1 cut(s) 174
PsuI RGATCY 2 cut(s) 311, 413
RsaI GTAC 2 cut(s) 189, 377
RsaNI GTAC 2 cut(s) 188, 376
SaqAI TTAA 3 cut(s) 132, 237, 244
SatI GCNGC 2 cut(s) 348, 351
Sau3AI GATC 3 cut(s) 176, 311, 413
Sau96I GGNCC 1 cut(s) 171
SetI ASST 5 cut(s) 89, 173, 206, 214, 482
SfcI CTRYAG 1 cut(s) 223
SinI GGWCC 1 cut(s) 171
SmlI CTYRAG 1 cut(s) 105
SmoI CTYRAG 1 cut(s) 105
Sse9I AATT 1 cut(s) 241
SspMI CTAG 1 cut(s) 46
StyI CCWWGG 2 cut(s) 292, 452
TasI AATT 1 cut(s) 241
TfiI GAWTC 2 cut(s) 142, 215
Tru1I TTAA 3 cut(s) 132, 237, 244
Tru9I TTAA 3 cut(s) 132, 237, 244
TseI GCWGC 2 cut(s) 347, 350
TspDTI ATGAA 2 cut(s) 79, 97
VpaK11BI GGWCC 1 cut(s) 171
XspI CTAG 1 cut(s) 46
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.