Rmu_sc0030339.1_g000001

Regulatory subunit of the condensin complex, a complex required for conversion of interphase chromatin into mitotic-like condense chromosomes

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0030339.1
Physical Location & Seq
Reverse (-)
2 .. 1444
1443 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0030339.1_g000001.1.cds

Sequence Viewer

Length: 715 bp
atgaggtttatattacatacagatatactattcatagaaccggaaaatgaactaagttctttccatgaacctgattttgatgacagacttgagaaagttgatggctttttgtttttaagtcttggattcacttcaaaacaaaatgcttgggcaggtcctgatcattggaagtaccaaaaaactaaaggttccgaggtgaatcctcctgcagaaccaccattaacaattaagcgacaaagaagcaaacaacagcctgatattgatttcacaaaagccttggaagaagaaatgtcagatctatttgctccccccaaaaaccccaagtcgttgctgctgcctgcaaatagagcaagttgcagtacgaaacttcctgaggattgccactatcaaccagaggatcttatcaagttattccttctacccaatgtaaagtgccttggaaggagagggaagaagtcctcagatcaatcaaggcaacaatatgatgattgtgggcaatcttcattttgtgatgatggtggtggccagtatgatgacggccaatatgatgagggaaatgtccatagtgatgtagaggactttagcacacttgtttctcaacctcgccaggtaaacaaaattgaagtccagtatgacaagacgtccaaacaagttgatgtccaggctttgaaagaaaccctttggggccatgtacaagaaactgttcaaaagtcta

Protein Analysis

238

Amino Acids

27.17

Weight (kDa)

5.04

Isoelectric Point (pI)

60.18

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 644
Acc36I ACCTGC 1 cut(s) 143
AclWI GGATC 1 cut(s) 405
AcoI YGGCCR 2 cut(s) 523, 538
AcyI GRCGYC 1 cut(s) 641
AfaI GTAC 3 cut(s) 173, 361, 693
AgsI TTSAA 4 cut(s) 135, 623, 670, 707
AhdI GACNNNNNGTC 1 cut(s) 640
AjnI CCWGG 2 cut(s) 606, 660
AlwI GGATC 1 cut(s) 405
AlwNI CAGNNNCTG 1 cut(s) 158
AoxI GGCC 3 cut(s) 523, 538, 685
ApeKI GCWGC 2 cut(s) 331, 334
ArsI GACNNNNNNTTYG 2 cut(s) 609, 641
Asp700I GAANNNNTTC 1 cut(s) 702
AspS9I GGNCC 2 cut(s) 155, 685
AsuHPI GGTGA 1 cut(s) 208
AvaII GGWCC 1 cut(s) 155
AxyI CCTNAGG 1 cut(s) 372
BalI TGGCCA 1 cut(s) 525
BbvI GCAGC 2 cut(s) 318, 321
BccI CCATC 2 cut(s) 95, 509
BceAI ACGGC 1 cut(s) 553
BciT130I CCWGG 2 cut(s) 608, 662
BclI TGATCA 1 cut(s) 160
BfmI CTRYAG 1 cut(s) 207
BfuAI ACCTGC 1 cut(s) 143
BglII AGATCT 1 cut(s) 295
BisI GCNGC 2 cut(s) 332, 335
BlsI GCNGC 2 cut(s) 333, 336
Bme1390I CCNGG 2 cut(s) 608, 662
Bme18I GGWCC 1 cut(s) 155
BmeRI GACNNNNNGTC 1 cut(s) 640
BmgT120I GGNCC 2 cut(s) 155, 685
BmiI GGNNCC 2 cut(s) 190, 686
BmrFI CCNGG 2 cut(s) 608, 662
BpuEI CTTGAG 1 cut(s) 110
BsaHI GRCGYC 1 cut(s) 641
BsaJI CCNNGG 3 cut(s) 192, 276, 436
BsaWI WCCGGW 1 cut(s) 40
Bse1I ACTGG 2 cut(s) 526, 628
Bse21I CCTNAGG 1 cut(s) 372
BseBI CCWGG 2 cut(s) 608, 662
BseDI CCNNGG 3 cut(s) 192, 276, 436
BseMII CTCAG 2 cut(s) 363, 474
BseNI ACTGG 2 cut(s) 526, 628
BseXI GCAGC 2 cut(s) 318, 321
BshFI GGCC 3 cut(s) 525, 540, 687
BsiSI CCGG 1 cut(s) 41
BsnI GGCC 3 cut(s) 525, 540, 687
Bsp1407I TGTACA 1 cut(s) 691
Bsp143I GATC 4 cut(s) 160, 295, 397, 463
BspANI GGCC 3 cut(s) 525, 540, 687
BspCNI CTCAG 2 cut(s) 364, 473
BspLI GGNNCC 2 cut(s) 190, 686
BspMAI CTGCAG 1 cut(s) 211
BspMI ACCTGC 1 cut(s) 143
BspPI GGATC 1 cut(s) 405
BsrGI TGTACA 1 cut(s) 691
BsrI ACTGG 2 cut(s) 526, 628
BssECI CCNNGG 3 cut(s) 192, 276, 436
BssMI GATC 4 cut(s) 160, 295, 397, 463
BssNI GRCGYC 1 cut(s) 641
BssT1I CCWWGG 2 cut(s) 276, 436
Bst2UI CCWGG 2 cut(s) 608, 662
Bst4CI ACNGT 1 cut(s) 703
BstACI GRCGYC 1 cut(s) 641
BstAUI TGTACA 1 cut(s) 691
BstC8I GCNNGC 1 cut(s) 339
BstDEI CTNAG 3 cut(s) 53, 372, 460
BstKTI GATC 4 cut(s) 163, 298, 400, 466
BstMBI GATC 4 cut(s) 160, 295, 397, 463
BstMWI GCNNNNNNNGC 1 cut(s) 347
BstNI CCWGG 2 cut(s) 608, 662
BstSCI CCNGG 2 cut(s) 606, 660
BstSFI CTRYAG 1 cut(s) 207
BstV1I GCAGC 2 cut(s) 318, 321
BstX2I RGATCY 2 cut(s) 295, 397
BstYI RGATCY 2 cut(s) 295, 397
Bsu36I CCTNAGG 1 cut(s) 372
BsuRI GGCC 3 cut(s) 525, 540, 687
BveI ACCTGC 1 cut(s) 143
Cac8I GCNNGC 1 cut(s) 339
CaiI CAGNNNCTG 1 cut(s) 158
Cfr13I GGNCC 2 cut(s) 155, 685
Csp6I GTAC 3 cut(s) 172, 360, 692
CviAII CATG 2 cut(s) 65, 689
CviJI RGCY 7 cut(s) 105, 253, 275, 525, 540, 665, 687
CviKI_1 RGCY 7 cut(s) 105, 253, 275, 525, 540, 665, 687
CviQI GTAC 3 cut(s) 172, 360, 692
DdeI CTNAG 3 cut(s) 53, 372, 460
DpnI GATC 4 cut(s) 162, 297, 399, 465
DpnII GATC 4 cut(s) 160, 295, 397, 463
DriI GACNNNNNGTC 1 cut(s) 640
EaeI YGGCCR 2 cut(s) 523, 538
Eam1105I GACNNNNNGTC 1 cut(s) 640
Eco130I CCWWGG 2 cut(s) 276, 436
Eco47I GGWCC 1 cut(s) 155
Eco81I CCTNAGG 1 cut(s) 372
EcoO109I RGGNCCY 1 cut(s) 155
EcoRII CCWGG 2 cut(s) 606, 660
EcoT14I CCWWGG 2 cut(s) 276, 436
ErhI CCWWGG 2 cut(s) 276, 436
FaeI CATG 2 cut(s) 68, 692
FalI AAGNNNNNCTT 2 cut(s) 663, 695
FatI CATG 2 cut(s) 64, 688
FbaI TGATCA 1 cut(s) 160
Fnu4HI GCNGC 2 cut(s) 332, 335
Fsp4HI GCNGC 2 cut(s) 332, 335
GluI GCNGC 2 cut(s) 332, 335
HaeIII GGCC 3 cut(s) 525, 540, 687
HapII CCGG 1 cut(s) 41
Hin1I GRCGYC 1 cut(s) 641
Hin1II CATG 2 cut(s) 68, 692
HinfI GANTC 2 cut(s) 126, 199
HpaII CCGG 1 cut(s) 41
HphI GGTGA 1 cut(s) 208
Hpy166II GTNNAC 1 cut(s) 613
Hpy188I TCNGA 3 cut(s) 193, 295, 463
Hpy188III TCNNGA 2 cut(s) 158, 371
Hpy8I GTNNAC 1 cut(s) 613
HpyAV CCTTC 2 cut(s) 425, 435
HpyCH4III ACNGT 1 cut(s) 703
HpyCH4IV ACGT 1 cut(s) 641
HpyCH4V TGCA 3 cut(s) 209, 341, 357
HpyF10VI GCNNNNNNNGC 1 cut(s) 347
HpyF3I CTNAG 3 cut(s) 53, 372, 460
HpySE526I ACGT 1 cut(s) 641
Hsp92I GRCGYC 1 cut(s) 641
Hsp92II CATG 2 cut(s) 68, 692
Ksp22I TGATCA 1 cut(s) 160
Kzo9I GATC 4 cut(s) 160, 295, 397, 463
LmnI GCTCC 1 cut(s) 310
Lsp1109I GCAGC 2 cut(s) 318, 321
MaeII ACGT 1 cut(s) 641
MalI GATC 4 cut(s) 162, 297, 399, 465
MboI GATC 4 cut(s) 160, 295, 397, 463
MboII GAAGA 4 cut(s) 293, 296, 463, 492
MflI RGATCY 2 cut(s) 295, 397
MlsI TGGCCA 1 cut(s) 525
MluCI AATT 2 cut(s) 225, 618
MluNI TGGCCA 1 cut(s) 525
MnlI CCTC 9 cut(s) 187, 213, 367, 388, 440, 469, 544, 568, 612
Mox20I TGGCCA 1 cut(s) 525
MroXI GAANNNNTTC 1 cut(s) 702
MscI TGGCCA 1 cut(s) 525
MseI TTAA 3 cut(s) 116, 221, 228
MslI CAYNNNNRTG 1 cut(s) 567
Msp20I TGGCCA 1 cut(s) 525
MspI CCGG 1 cut(s) 41
MspR9I CCNGG 2 cut(s) 608, 662
MvaI CCWGG 2 cut(s) 608, 662
MwoI GCNNNNNNNGC 1 cut(s) 347
NdeII GATC 4 cut(s) 160, 295, 397, 463
NlaIII CATG 2 cut(s) 68, 692
NlaIV GGNNCC 2 cut(s) 190, 686
PdmI GAANNNNTTC 1 cut(s) 702
PfeI GAWTC 2 cut(s) 126, 199
PkrI GCNGC 2 cut(s) 333, 336
PpuMI RGGWCCY 1 cut(s) 155
Psp5II RGGWCCY 1 cut(s) 155
Psp6I CCWGG 2 cut(s) 606, 660
PspGI CCWGG 2 cut(s) 606, 660
PspN4I GGNNCC 2 cut(s) 190, 686
PspPI GGNCC 2 cut(s) 155, 685
PspPPI RGGWCCY 1 cut(s) 155
PstI CTGCAG 1 cut(s) 211
PstNI CAGNNNCTG 1 cut(s) 158
PsuI RGATCY 2 cut(s) 295, 397
RsaI GTAC 3 cut(s) 173, 361, 693
RsaNI GTAC 3 cut(s) 172, 360, 692
RseI CAYNNNNRTG 1 cut(s) 567
SaqAI TTAA 3 cut(s) 116, 221, 228
SatI GCNGC 2 cut(s) 332, 335
Sau3AI GATC 4 cut(s) 160, 295, 397, 463
Sau96I GGNCC 2 cut(s) 155, 685
ScrFI CCNGG 2 cut(s) 608, 662
SetI ASST 8 cut(s) 8, 73, 157, 190, 198, 604, 612, 644
SfcI CTRYAG 1 cut(s) 207
SinI GGWCC 1 cut(s) 155
SmiMI CAYNNNNRTG 1 cut(s) 567
SmlI CTYRAG 1 cut(s) 89
SmoI CTYRAG 1 cut(s) 89
Sse9I AATT 2 cut(s) 225, 618
StyD4I CCNGG 2 cut(s) 606, 660
StyI CCWWGG 2 cut(s) 276, 436
TaaI ACNGT 1 cut(s) 703
TaiI ACGT 1 cut(s) 644
TasI AATT 2 cut(s) 225, 618
TatI WGTACW 1 cut(s) 691
TfiI GAWTC 2 cut(s) 126, 199
Tru1I TTAA 3 cut(s) 116, 221, 228
Tru9I TTAA 3 cut(s) 116, 221, 228
TseI GCWGC 2 cut(s) 331, 334
TspDTI ATGAA 4 cut(s) 22, 63, 81, 492
VpaK11BI GGWCC 1 cut(s) 155
XmnI GAANNNNTTC 1 cut(s) 702
ZraI GACGTC 1 cut(s) 642
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.