Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0042494.1

Orthogroup ID

OG0002141

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 2090

Gene Structure 2090 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0042494.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1017 bp

atggaggatggcaatgtcagcgatgggaaggataagagtcagtgtaagaaagaggtggagcggaaggtatcaccactatcaacattggaatcgtcctttgaagctctgaacttaaagaagtttgaagttgcattagtggtagatcccctgtatcatcagacatctgcacagtttgatgaaggtggagccaagggtctgctattgaataatcttggagtatatggaaggtgccaggtgctttttgattcttcagaaattccaaggaagtgcagatcatgtcgattgaaaaataaagccttggatttgatagatttatcttttgagaaagaatcaattcagcagatggtgactcacatgcttggaaaaaatgaaatttctcctactgtaaatgatatactatgccgtattgataaagataatcgacgaccagcacaagtttttaatataacgcagaatccagatcttcctgatgatgcatttgatgataacgaagttgggttagacttttcatctgggagatatgacatggcgaccattgaacatgaccgtgaacatgaacgtgatgatgatatatatgtcagtcatgaggatgtaaattttggaacatttcaaagtcatcaggaggataataactcgtacacatcagttgaagctgatatggatgccagatttgaggaagtttccacgtttttgttacaagggttggcaatcacttccaagaaaaatgcatgggctggtcctgatcactggaaatattggaggtctaagggttcagaggatgctcctgccactccaagtacaccaactaataagagatcaaagaacaaaaacaatacacaagttgagcttgttttcacaacatctatagacaaagaatttccagatatattttctccaccaaaaaatttgaagtccttactcctatctgcaaatagagtaccaagtcacaggcttccagaagattgccattatccagctgacgatcttgtcaagttgttccttcttcctagtgttctg

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko04111 map04111

Pfam Domains

Protein Families

Cnd2

Protein Analysis

339

Amino Acids

38.36

Weight (kDa)

5.04

Isoelectric Point (pI)

42.61

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002141)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G32590
fragaria_vesca	FvH4_3g23280 FvH4_3g23280 FvH4_3g23280 FvH4_3g23280 FvH4_3g23280 FvH4_6g42730 FvH4_6g42730 FvH4_6g42730
malus_domestica	MD03G1195600.v1.1 MD03G1195700.v1.1 MD09G1071300.v1.1 MD11G1212100.v1.1 MD17G1101300.v1.1
prunus_persica	Prupe.3G213700_v2.0.a1 Prupe.4G220400_v2.0.a1
pyrus_communis	pycom03g14790 pycom09g03480 pycom17g09560 pycom17g09570
rosa_chinensis	RchiOBHm_Chr2g0158621 RchiOBHm_Chr5g0041001
rosa_laevigata	RLG00000021100 RLG00000034019
rosa_multiflora	Rmu_co8379437.1_g000001 Rmu_sc0005650.1_g000010 Rmu_sc0030339.1_g000001 Rmu_sc0040010.1_g000001 Rmu_sc0042494.1_g000001 Rmu_ssc0000284.1_g000007
rosa_roxburghii	Rroxscaffold_1G00039700 Rroxscaffold_2G00091170
rosa_rugosa	Rorug02G0471000 Rorug05G0189400
rosa_samantha	Rh2AG536600 Rh2BG549700 Rh2CG520300 Rh2DG559400 Rh5AG274600 Rh5BG279900 Rh5CG312000 Rh5DG287900
rosa_wichuraiana	Rw2G044420 Rw5G025870

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	986
AccB1I	GGYRCC	1 cut(s)	228
AccBSI	CCGCTC	1 cut(s)	61
AciI	CCGC	1 cut(s)	61
AclWI	GGATC	1 cut(s)	137
AcsI	RAATTY	5 cut(s)	255, 372, 595, 875, 904
AcuI	CTGAAG	1 cut(s)	234
AfaI	GTAC	3 cut(s)	638, 799, 939
AgsI	TTSAA	8 cut(s)	101, 125, 205, 286, 539, 611, 650, 910
AjnI	CCWGG	1 cut(s)	231
AluBI	AGCT	4 cut(s)	104, 653, 847, 977
AluI	AGCT	4 cut(s)	104, 653, 847, 977
AlwI	GGATC	1 cut(s)	137
ApoI	RAATTY	5 cut(s)	255, 372, 595, 875, 904
Asp700I	GAANNNNTTC	1 cut(s)	333
AspS9I	GGNCC	1 cut(s)	737
AsuHPI	GGTGA	2 cut(s)	63, 358
AvaII	GGWCC	1 cut(s)	737
BanI	GGYRCC	1 cut(s)	228
BccI	CCATC	3 cut(s)	2, 17, 337
BceAI	ACGGC	1 cut(s)	387
BciT130I	CCWGG	1 cut(s)	233
BclI	TGATCA	1 cut(s)	742
BfaI	CTAG	1 cut(s)	1008
BfmI	CTRYAG	1 cut(s)	864
BglII	AGATCT	1 cut(s)	460
Bme1390I	CCNGG	1 cut(s)	233
Bme18I	GGWCC	1 cut(s)	737
BmgT120I	GGNCC	1 cut(s)	737
BmiI	GGNNCC	2 cut(s)	187, 230
BmrFI	CCNGG	1 cut(s)	233
BmsI	GCATC	3 cut(s)	463, 652, 769
BsaJI	CCNNGG	3 cut(s)	189, 260, 297
Bse1I	ACTGG	1 cut(s)	752
Bse3DI	GCAATG	1 cut(s)	19
BseBI	CCWGG	1 cut(s)	233
BseDI	CCNNGG	3 cut(s)	189, 260, 297
BseGI	GGATG	4 cut(s)	13, 595, 667, 784
BseMI	GCAATG	1 cut(s)	19
BseNI	ACTGG	1 cut(s)	752
BsgI	GTGCAG	2 cut(s)	150, 289
BshNI	GGYRCC	1 cut(s)	228
Bsp143I	GATC	6 cut(s)	142, 272, 460, 742, 815, 982
BspACI	CCGC	1 cut(s)	61
BspHI	TCATGA	1 cut(s)	583
BspLI	GGNNCC	2 cut(s)	187, 230
BspPI	GGATC	1 cut(s)	137
BspT107I	GGYRCC	1 cut(s)	228
BsrBI	CCGCTC	1 cut(s)	61
BsrDI	GCAATG	1 cut(s)	19
BsrI	ACTGG	1 cut(s)	752
BssECI	CCNNGG	3 cut(s)	189, 260, 297
BssMI	GATC	6 cut(s)	142, 272, 460, 742, 815, 982
BssT1I	CCWWGG	3 cut(s)	189, 260, 297
Bst2UI	CCWGG	1 cut(s)	233
Bst4CI	ACNGT	3 cut(s)	171, 385, 548
BstDEI	CTNAG	1 cut(s)	765
BstF5I	GGATG	4 cut(s)	13, 595, 667, 784
BstKTI	GATC	6 cut(s)	145, 275, 463, 745, 818, 985
BstMBI	GATC	6 cut(s)	142, 272, 460, 742, 815, 982
BstMWI	GCNNNNNNNGC	1 cut(s)	18
BstNI	CCWGG	1 cut(s)	233
BstNSI	RCATGY	1 cut(s)	358
BstSCI	CCNGG	1 cut(s)	231
BstSFI	CTRYAG	1 cut(s)	864
BstX2I	RGATCY	2 cut(s)	142, 460
BstYI	RGATCY	2 cut(s)	142, 460
BtgZI	GCGATG	1 cut(s)	36
BtsCI	GGATG	4 cut(s)	13, 595, 667, 784
BtsIMutI	CAGTG	2 cut(s)	47, 745
CciI	TCATGA	1 cut(s)	583
Cfr13I	GGNCC	1 cut(s)	737
Csp6I	GTAC	3 cut(s)	637, 798, 938
CviAII	CATG	7 cut(s)	276, 355, 526, 542, 554, 584, 729
CviJI	RGCY	8 cut(s)	104, 188, 296, 653, 734, 847, 952, 977
CviKI_1	RGCY	8 cut(s)	104, 188, 296, 653, 734, 847, 952, 977
CviQI	GTAC	3 cut(s)	637, 798, 938
DdeI	CTNAG	1 cut(s)	765
DpnI	GATC	6 cut(s)	144, 274, 462, 744, 817, 984
DpnII	GATC	6 cut(s)	142, 272, 460, 742, 815, 982
DrdI	GACNNNNNNGTC	1 cut(s)	986
DseDI	GACNNNNNNGTC	1 cut(s)	986
Eco130I	CCWWGG	3 cut(s)	189, 260, 297
Eco47I	GGWCC	1 cut(s)	737
Eco57I	CTGAAG	1 cut(s)	234
EcoRII	CCWGG	1 cut(s)	231
EcoT14I	CCWWGG	3 cut(s)	189, 260, 297
EcoT22I	ATGCAT	2 cut(s)	478, 730
ErhI	CCWWGG	3 cut(s)	189, 260, 297
FaeI	CATG	7 cut(s)	279, 358, 529, 545, 557, 587, 732
FalI	AAGNNNNNCTT	2 cut(s)	831, 863
FatI	CATG	7 cut(s)	275, 354, 525, 541, 553, 583, 728
FbaI	TGATCA	1 cut(s)	742
FokI	GGATG	4 cut(s)	20, 602, 674, 791
FspBI	CTAG	1 cut(s)	1008
Hin1II	CATG	7 cut(s)	279, 358, 529, 545, 557, 587, 732
HinfI	GANTC	6 cut(s)	37, 89, 245, 329, 349, 454
HphI	GGTGA	2 cut(s)	63, 358
Hpy166II	GTNNAC	3 cut(s)	551, 639, 800
Hpy188I	TCNGA	4 cut(s)	108, 159, 253, 775
Hpy188III	TCNNGA	7 cut(s)	458, 467, 584, 620, 740, 881, 956
Hpy8I	GTNNAC	3 cut(s)	551, 639, 800
Hpy99I	CGWCG	1 cut(s)	426
HpyAV	CCTTC	5 cut(s)	22, 58, 173, 219, 1010
HpyCH4III	ACNGT	3 cut(s)	171, 385, 548
HpyCH4IV	ACGT	2 cut(s)	559, 686
HpyCH4V	TGCA	6 cut(s)	131, 167, 270, 476, 728, 929
HpyF10VI	GCNNNNNNNGC	1 cut(s)	18
HpyF3I	CTNAG	1 cut(s)	765
HpySE526I	ACGT	2 cut(s)	559, 686
Hsp92II	CATG	7 cut(s)	279, 358, 529, 545, 557, 587, 732
Ksp22I	TGATCA	1 cut(s)	742
Kzo9I	GATC	6 cut(s)	142, 272, 460, 742, 815, 982
LmnI	GCTCC	3 cut(s)	58, 185, 787
LweI	GCATC	3 cut(s)	463, 652, 769
MaeI	CTAG	1 cut(s)	1008
MaeII	ACGT	2 cut(s)	559, 686
MaeIII	GTNAC	3 cut(s)	346, 693, 944
MalI	GATC	6 cut(s)	144, 274, 462, 744, 817, 984
MbiI	CCGCTC	1 cut(s)	61
MboI	GATC	6 cut(s)	142, 272, 460, 742, 815, 982
MboII	GAAGA	4 cut(s)	240, 455, 971, 995
MflI	RGATCY	2 cut(s)	142, 460
MluCI	AATT	6 cut(s)	255, 333, 372, 595, 875, 904
MlyI	GAGTC	2 cut(s)	46, 343
MnlI	CCTC	6 cut(s)	46, 580, 616, 667, 753, 769
Mph1103I	ATGCAT	2 cut(s)	478, 730
MroXI	GAANNNNTTC	1 cut(s)	333
MseI	TTAA	2 cut(s)	113, 441
MslI	CAYNNNNRTG	3 cut(s)	546, 558, 588
MspA1I	CMGCKG	1 cut(s)	977
MspR9I	CCNGG	1 cut(s)	233
MvaI	CCWGG	1 cut(s)	233
MwoI	GCNNNNNNNGC	1 cut(s)	18
NdeII	GATC	6 cut(s)	142, 272, 460, 742, 815, 982
NlaIII	CATG	7 cut(s)	279, 358, 529, 545, 557, 587, 732
NlaIV	GGNNCC	2 cut(s)	187, 230
NmuCI	GTSAC	2 cut(s)	346, 944
NsiI	ATGCAT	2 cut(s)	478, 730
NspI	RCATGY	1 cut(s)	358
PagI	TCATGA	1 cut(s)	583
PdmI	GAANNNNTTC	1 cut(s)	333
PfeI	GAWTC	4 cut(s)	89, 245, 329, 454
PleI	GAGTC	2 cut(s)	45, 343
PpsI	GAGTC	2 cut(s)	45, 343
Psp6I	CCWGG	1 cut(s)	231
PspGI	CCWGG	1 cut(s)	231
PspN4I	GGNNCC	2 cut(s)	187, 230
PspPI	GGNCC	1 cut(s)	737
PsuI	RGATCY	2 cut(s)	142, 460
PvuII	CAGCTG	1 cut(s)	977
RsaI	GTAC	3 cut(s)	638, 799, 939
RsaNI	GTAC	3 cut(s)	637, 798, 938
RseI	CAYNNNNRTG	3 cut(s)	546, 558, 588
SaqAI	TTAA	2 cut(s)	113, 441
Sau3AI	GATC	6 cut(s)	142, 272, 460, 742, 815, 982
Sau96I	GGNCC	1 cut(s)	737
SchI	GAGTC	2 cut(s)	46, 343
ScrFI	CCNGG	1 cut(s)	233
SfaNI	GCATC	3 cut(s)	463, 652, 769
SfcI	CTRYAG	1 cut(s)	864
SinI	GGWCC	1 cut(s)	737
SmiMI	CAYNNNNRTG	3 cut(s)	546, 558, 588
Sse9I	AATT	6 cut(s)	255, 333, 372, 595, 875, 904
SsiI	CCGC	1 cut(s)	61
SspI	AATATT	1 cut(s)	755
SspMI	CTAG	1 cut(s)	1008
StyD4I	CCNGG	1 cut(s)	231
StyI	CCWWGG	3 cut(s)	189, 260, 297
TaaI	ACNGT	3 cut(s)	171, 385, 548
TaiI	ACGT	2 cut(s)	562, 689
TaqI	TCGA	2 cut(s)	280, 421
TasI	AATT	6 cut(s)	255, 333, 372, 595, 875, 904
TatI	WGTACW	1 cut(s)	797
TfiI	GAWTC	4 cut(s)	89, 245, 329, 454
Tru1I	TTAA	2 cut(s)	113, 441
Tru9I	TTAA	2 cut(s)	113, 441
TscAI	CASTG	2 cut(s)	47, 752
TseFI	GTSAC	2 cut(s)	346, 944
Tsp45I	GTSAC	2 cut(s)	346, 944
TspDTI	ATGAA	4 cut(s)	192, 384, 498, 570
TspRI	CASTG	2 cut(s)	47, 752
VpaK11BI	GGWCC	1 cut(s)	737
XapI	RAATTY	5 cut(s)	255, 372, 595, 875, 904
XceI	RCATGY	1 cut(s)	358
XmnI	GAANNNNTTC	1 cut(s)	333
XspI	CTAG	1 cut(s)	1008
Zsp2I	ATGCAT	2 cut(s)	478, 730

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.