RchiOBHm_Chr5g0067621

XH domain

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
73744094 .. 73744938
845 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 357 bp
ATGGAAATTGAAGAATTAAATGGTAAATTAGAGGTGATGAAGCATCTTGGGGATGAAGATGATGAAGCTGTTAAAAAGAAGATTGAAGACATGAATCAAGAATTGGGGGAAAAAGTTAAAGAGCTTGAGCATTTGGAAATACTGAATCAAACTCTGATCACCAAAGAGCGCCAGAGCAATGATGAGTTACAAGAAGCTCGTAAAGTGTTAATAGCAATATCCTACTGTCATAGATTCATACATATATTGAAACAAAATATTTGTACTCTTATGTTTCTTTTTTTCCCTACATATAAGAGACAGAAAATGATTTGTAACTATACTATGTTTCCTCGCATGAAAGCTCATACTGTTTGA

Protein Analysis

118

Amino Acids

14.1

Weight (kDa)

6.21

Isoelectric Point (pI)

56.39

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 265
AgsI TTSAA 3 cut(s) 11, 86, 250
AjuI GAANNNNNNNTTGG 2 cut(s) 86, 118
AluBI AGCT 4 cut(s) 68, 124, 197, 344
AluI AGCT 4 cut(s) 68, 124, 197, 344
Alw26I GTCTC 1 cut(s) 292
AspLEI GCGC 1 cut(s) 171
AsuHPI GGTGA 2 cut(s) 46, 151
BbsI GAAGAC 1 cut(s) 93
BclI TGATCA 1 cut(s) 156
BcoDI GTCTC 1 cut(s) 292
BfoI RGCGCY 1 cut(s) 172
BmsI GCATC 1 cut(s) 52
BpiI GAAGAC 1 cut(s) 93
BpuEI CTTGAG 1 cut(s) 146
Bse3DI GCAATG 1 cut(s) 184
BseGI GGATG 1 cut(s) 58
BseMI GCAATG 1 cut(s) 184
BsmAI GTCTC 1 cut(s) 292
Bsp143I GATC 1 cut(s) 156
BsrDI GCAATG 1 cut(s) 184
BssMI GATC 1 cut(s) 156
Bst4CI ACNGT 2 cut(s) 227, 352
BstF5I GGATG 1 cut(s) 58
BstH2I RGCGCY 1 cut(s) 172
BstHHI GCGC 1 cut(s) 171
BstKTI GATC 1 cut(s) 159
BstMAI GTCTC 1 cut(s) 292
BstMBI GATC 1 cut(s) 156
BstV2I GAAGAC 1 cut(s) 93
BtsCI GGATG 1 cut(s) 58
CfoI GCGC 1 cut(s) 171
Csp6I GTAC 1 cut(s) 264
CviAII CATG 2 cut(s) 91, 337
CviJI RGCY 4 cut(s) 68, 124, 197, 344
CviKI_1 RGCY 4 cut(s) 68, 124, 197, 344
CviQI GTAC 1 cut(s) 264
DpnI GATC 1 cut(s) 158
DpnII GATC 1 cut(s) 156
FaeI CATG 2 cut(s) 94, 340
FatI CATG 2 cut(s) 90, 336
FbaI TGATCA 1 cut(s) 156
FokI GGATG 1 cut(s) 65
GlaI GCGC 1 cut(s) 170
HaeII RGCGCY 1 cut(s) 172
HhaI GCGC 1 cut(s) 171
Hin1II CATG 2 cut(s) 94, 340
Hin6I GCGC 1 cut(s) 169
HinP1I GCGC 1 cut(s) 169
HinfI GANTC 3 cut(s) 94, 145, 234
HphI GGTGA 2 cut(s) 46, 151
Hpy188I TCNGA 1 cut(s) 156
Hpy188III TCNNGA 1 cut(s) 98
HpyCH4III ACNGT 2 cut(s) 227, 352
Hsp92II CATG 2 cut(s) 94, 340
HspAI GCGC 1 cut(s) 169
Ksp22I TGATCA 1 cut(s) 156
Kzo9I GATC 1 cut(s) 156
LpnPI CCDG 1 cut(s) 185
LweI GCATC 1 cut(s) 52
MaeIII GTNAC 2 cut(s) 186, 314
MalI GATC 1 cut(s) 158
MboI GATC 1 cut(s) 156
MboII GAAGA 4 cut(s) 23, 68, 91, 98
MluCI AATT 4 cut(s) 6, 14, 26, 101
MnlI CCTC 2 cut(s) 25, 342
MseI TTAA 4 cut(s) 17, 72, 117, 209
NdeII GATC 1 cut(s) 156
NlaIII CATG 2 cut(s) 94, 340
PfeI GAWTC 3 cut(s) 94, 145, 234
RsaI GTAC 1 cut(s) 265
RsaNI GTAC 1 cut(s) 264
SaqAI TTAA 4 cut(s) 17, 72, 117, 209
Sau3AI GATC 1 cut(s) 156
SetI ASST 5 cut(s) 36, 70, 126, 199, 346
SfaNI GCATC 1 cut(s) 52
SgeI CNNG 9 cut(s) 59, 103, 110, 137, 184, 203, 210, 345, 349
SmlI CTYRAG 1 cut(s) 125
SmoI CTYRAG 1 cut(s) 125
Sse9I AATT 4 cut(s) 6, 14, 26, 101
SspI AATATT 1 cut(s) 259
TaaI ACNGT 2 cut(s) 227, 352
TasI AATT 4 cut(s) 6, 14, 26, 101
TatI WGTACW 1 cut(s) 263
TfiI GAWTC 3 cut(s) 94, 145, 234
Tru1I TTAA 4 cut(s) 17, 72, 117, 209
Tru9I TTAA 4 cut(s) 17, 72, 117, 209
TspDTI ATGAA 6 cut(s) 53, 69, 78, 107, 226, 353
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.