Rh1AG154300

XH domain

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1A
Physical Location & Seq
Forward (+)
28834833 .. 28836568
1736 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1AG154300.1

Sequence Viewer

Length: 237 bp
ATGGAAATTGAAGAATTAAATAGTAAATTAGAGGTGATGAAGCATCTTGGGGATGAAGATGATGAAGCCGTTAAAAAGAAGATTGAAGACATGAATCAAGAATTGGGGGAAAAAGTTAAAGAGCTTGAGCATTTAGAAATACTGAATCAAACTCTGATCACCAAAGAGCGCCAGAGCAATGATGAGTTACAAGAAGCTCTAACTGCACCGGAAGAACTGCTTCCACAATCTGTAGAG

Protein Analysis

79

Amino Acids

9.16

Weight (kDa)

4.38

Isoelectric Point (pI)

65.75

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 2 cut(s) 11, 86
AjuI GAANNNNNNNTTGG 2 cut(s) 86, 118
AluBI AGCT 2 cut(s) 124, 197
AluI AGCT 2 cut(s) 124, 197
Asp700I GAANNNNTTC 1 cut(s) 219
AspLEI GCGC 1 cut(s) 171
AsuHPI GGTGA 2 cut(s) 46, 151
BbsI GAAGAC 1 cut(s) 93
BceAI ACGGC 1 cut(s) 53
BclI TGATCA 1 cut(s) 156
BfmI CTRYAG 1 cut(s) 231
BfoI RGCGCY 1 cut(s) 172
BmsI GCATC 1 cut(s) 52
BpiI GAAGAC 1 cut(s) 93
BpuEI CTTGAG 1 cut(s) 146
BsaWI WCCGGW 1 cut(s) 208
Bse3DI GCAATG 1 cut(s) 184
BseGI GGATG 1 cut(s) 58
BseMI GCAATG 1 cut(s) 184
BsgI GTGCAG 1 cut(s) 189
BsiSI CCGG 1 cut(s) 209
Bsp143I GATC 1 cut(s) 156
BsrDI GCAATG 1 cut(s) 184
BssMI GATC 1 cut(s) 156
BstF5I GGATG 1 cut(s) 58
BstH2I RGCGCY 1 cut(s) 172
BstHHI GCGC 1 cut(s) 171
BstKTI GATC 1 cut(s) 159
BstMBI GATC 1 cut(s) 156
BstMWI GCNNNNNNNGC 1 cut(s) 203
BstSFI CTRYAG 1 cut(s) 231
BstV2I GAAGAC 1 cut(s) 93
BtsCI GGATG 1 cut(s) 58
CfoI GCGC 1 cut(s) 171
CviAII CATG 1 cut(s) 91
CviJI RGCY 3 cut(s) 68, 124, 197
CviKI_1 RGCY 3 cut(s) 68, 124, 197
DpnI GATC 1 cut(s) 158
DpnII GATC 1 cut(s) 156
FaeI CATG 1 cut(s) 94
FaiI YATR 1 cut(s) 92
FalI AAGNNNNNCTT 2 cut(s) 204, 236
FatI CATG 1 cut(s) 90
FbaI TGATCA 1 cut(s) 156
FokI GGATG 1 cut(s) 65
GlaI GCGC 1 cut(s) 170
HaeII RGCGCY 1 cut(s) 172
HapII CCGG 1 cut(s) 209
HhaI GCGC 1 cut(s) 171
Hin1II CATG 1 cut(s) 94
Hin6I GCGC 1 cut(s) 169
HinP1I GCGC 1 cut(s) 169
HinfI GANTC 2 cut(s) 94, 145
HpaII CCGG 1 cut(s) 209
HphI GGTGA 2 cut(s) 46, 151
Hpy188I TCNGA 1 cut(s) 156
Hpy188III TCNNGA 1 cut(s) 98
HpyCH4V TGCA 1 cut(s) 206
HpyF10VI GCNNNNNNNGC 1 cut(s) 203
Hsp92II CATG 1 cut(s) 94
HspAI GCGC 1 cut(s) 169
Ksp22I TGATCA 1 cut(s) 156
Kzo9I GATC 1 cut(s) 156
LpnPI CCDG 2 cut(s) 185, 222
LweI GCATC 1 cut(s) 52
MaeIII GTNAC 1 cut(s) 186
MalI GATC 1 cut(s) 158
MboI GATC 1 cut(s) 156
MboII GAAGA 5 cut(s) 23, 68, 91, 98, 224
MluCI AATT 4 cut(s) 6, 14, 26, 101
MnlI CCTC 1 cut(s) 25
MroXI GAANNNNTTC 1 cut(s) 219
MseI TTAA 3 cut(s) 17, 72, 117
MspI CCGG 1 cut(s) 209
MwoI GCNNNNNNNGC 1 cut(s) 203
NdeII GATC 1 cut(s) 156
NlaIII CATG 1 cut(s) 94
PdmI GAANNNNTTC 1 cut(s) 219
PfeI GAWTC 2 cut(s) 94, 145
SaqAI TTAA 3 cut(s) 17, 72, 117
Sau3AI GATC 1 cut(s) 156
SetI ASST 3 cut(s) 36, 126, 199
SfaNI GCATC 1 cut(s) 52
SfcI CTRYAG 1 cut(s) 231
SgeI CNNG 7 cut(s) 59, 103, 110, 137, 184, 203, 221
SmlI CTYRAG 1 cut(s) 125
SmoI CTYRAG 1 cut(s) 125
Sse9I AATT 4 cut(s) 6, 14, 26, 101
TasI AATT 4 cut(s) 6, 14, 26, 101
TfiI GAWTC 2 cut(s) 94, 145
Tru1I TTAA 3 cut(s) 17, 72, 117
Tru9I TTAA 3 cut(s) 17, 72, 117
TspDTI ATGAA 4 cut(s) 53, 69, 78, 107
XmnI GAANNNNTTC 1 cut(s) 219
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.