Rh2AG275800

XH domain

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
Physical Location & Seq
Reverse (-)
33019790 .. 33022785
2996 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG275800.1

Sequence Viewer

Length: 288 bp
ATGGAAATTGAAGAATTAAATGGTAAATTAGAGGTGATGAAGCATCTTGGGGATGAAGATGATGAAGCCGTTAAAAAGAAGATTGAAGACATGAATCAAGAGTTGGGGGAAAAAGTTAAAGAGCTTGAGCATTTAGAAATACTGAATCAAACTCTGATCACCAAAGAGCGCCAGAGCAATGATGAGTTACAAGAAGCTCGTAAAGTGTTAATAGCAAGCATTGAGCGCTATAGGATTTGTCTATGCAAAAATAGCAGGCTCGCAAGATTTGAATTGCTGAAAAAGTAA

Protein Analysis

95

Amino Acids

11.22

Weight (kDa)

5.3

Isoelectric Point (pI)

42.23

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfeI AGCGCT 1 cut(s) 227
AgsI TTSAA 3 cut(s) 11, 86, 272
AjuI GAANNNNNNNTTGG 2 cut(s) 86, 118
AluBI AGCT 2 cut(s) 124, 197
AluI AGCT 2 cut(s) 124, 197
Aor51HI AGCGCT 1 cut(s) 227
AspLEI GCGC 2 cut(s) 171, 228
AsuHPI GGTGA 2 cut(s) 46, 151
BbsI GAAGAC 1 cut(s) 93
BceAI ACGGC 1 cut(s) 53
BclI TGATCA 1 cut(s) 156
BfmI CTRYAG 1 cut(s) 229
BfoI RGCGCY 2 cut(s) 172, 229
BmsI GCATC 1 cut(s) 52
BpiI GAAGAC 1 cut(s) 93
BpuEI CTTGAG 1 cut(s) 146
Bse3DI GCAATG 1 cut(s) 184
BseGI GGATG 1 cut(s) 58
BseMI GCAATG 1 cut(s) 184
Bsp143I GATC 1 cut(s) 156
BsrDI GCAATG 1 cut(s) 184
BssMI GATC 1 cut(s) 156
BstC8I GCNNGC 3 cut(s) 217, 257, 261
BstF5I GGATG 1 cut(s) 58
BstH2I RGCGCY 2 cut(s) 172, 229
BstHHI GCGC 2 cut(s) 171, 228
BstKTI GATC 1 cut(s) 159
BstMBI GATC 1 cut(s) 156
BstMWI GCNNNNNNNGC 2 cut(s) 225, 252
BstSFI CTRYAG 1 cut(s) 229
BstV2I GAAGAC 1 cut(s) 93
BtsCI GGATG 1 cut(s) 58
Cac8I GCNNGC 3 cut(s) 217, 257, 261
CfoI GCGC 2 cut(s) 171, 228
CviAII CATG 1 cut(s) 91
CviJI RGCY 4 cut(s) 68, 124, 197, 259
CviKI_1 RGCY 4 cut(s) 68, 124, 197, 259
DpnI GATC 1 cut(s) 158
DpnII GATC 1 cut(s) 156
Eco47III AGCGCT 1 cut(s) 227
FaeI CATG 1 cut(s) 94
FaiI YATR 3 cut(s) 92, 231, 244
FatI CATG 1 cut(s) 90
FbaI TGATCA 1 cut(s) 156
FokI GGATG 1 cut(s) 65
GlaI GCGC 2 cut(s) 170, 227
HaeII RGCGCY 2 cut(s) 172, 229
HhaI GCGC 2 cut(s) 171, 228
Hin1II CATG 1 cut(s) 94
Hin6I GCGC 2 cut(s) 169, 226
HinP1I GCGC 2 cut(s) 169, 226
HinfI GANTC 2 cut(s) 94, 145
HphI GGTGA 2 cut(s) 46, 151
Hpy188I TCNGA 1 cut(s) 156
Hpy188III TCNNGA 1 cut(s) 98
HpyCH4V TGCA 1 cut(s) 246
HpyF10VI GCNNNNNNNGC 2 cut(s) 225, 252
Hsp92II CATG 1 cut(s) 94
HspAI GCGC 2 cut(s) 169, 226
Ksp22I TGATCA 1 cut(s) 156
Kzo9I GATC 1 cut(s) 156
LpnPI CCDG 2 cut(s) 185, 241
LweI GCATC 1 cut(s) 52
MaeIII GTNAC 1 cut(s) 186
MalI GATC 1 cut(s) 158
MboI GATC 1 cut(s) 156
MboII GAAGA 4 cut(s) 23, 68, 91, 98
MluCI AATT 4 cut(s) 6, 14, 26, 272
MnlI CCTC 1 cut(s) 25
MseI TTAA 4 cut(s) 17, 72, 117, 209
MwoI GCNNNNNNNGC 2 cut(s) 225, 252
NdeII GATC 1 cut(s) 156
NlaIII CATG 1 cut(s) 94
PfeI GAWTC 2 cut(s) 94, 145
SaqAI TTAA 4 cut(s) 17, 72, 117, 209
Sau3AI GATC 1 cut(s) 156
SetI ASST 3 cut(s) 36, 126, 199
SfaNI GCATC 1 cut(s) 52
SfcI CTRYAG 1 cut(s) 229
SmlI CTYRAG 1 cut(s) 125
SmoI CTYRAG 1 cut(s) 125
Sse9I AATT 4 cut(s) 6, 14, 26, 272
TasI AATT 4 cut(s) 6, 14, 26, 272
TfiI GAWTC 2 cut(s) 94, 145
Tru1I TTAA 4 cut(s) 17, 72, 117, 209
Tru9I TTAA 4 cut(s) 17, 72, 117, 209
TspDTI ATGAA 4 cut(s) 53, 69, 78, 107
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.