RchiOBHm_Chr4g0396861

Plant self-incompatibility protein S1

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
OG0004892
Physical Location & Seq
Forward (+)
13004180 .. 13004449
270 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 270 bp
ATGAGTCCTTTCCTGAGAAATGACCTTCCTCTCTTGCTCGTTTTTGTTGTTGTTCTTTCGATTACAACTAGTACTGAGGAAGGATTTGCACAGCCAAAGCATAGAAGGGTTAGGATCAGAAATTTACTGGAAAACACTACTGAAATCTTGAGAGTCCATTGCAAATCTAAAGACGATGACATTGGTTGGCATGACCTTGTTACCAGGGAAAGTTTCACATTCGAGTTCTATAGCAATATGGGCGGAACCACACTTCTTTTGCAGATTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Self-incomp_S1

Protein Analysis

89

Amino Acids

10.32

Weight (kDa)

6.26

Isoelectric Point (pI)

65.56

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Self-incomp_S1 PF05938 36 - 85 7.6e-12 Plant self-incompatibility protein S1
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 243
AclWI GGATC 1 cut(s) 122
AcsI RAATTY 1 cut(s) 121
AfaI GTAC 1 cut(s) 73
AhlI ACTAGT 1 cut(s) 68
AjnI CCWGG 1 cut(s) 203
AlwI GGATC 1 cut(s) 122
ApoI RAATTY 1 cut(s) 121
BciT130I CCWGG 1 cut(s) 205
BcuI ACTAGT 1 cut(s) 68
BfaI CTAG 1 cut(s) 69
BfmI CTRYAG 1 cut(s) 229
BmcAI AGTACT 1 cut(s) 73
Bme1390I CCNGG 1 cut(s) 205
BmiI GGNNCC 1 cut(s) 247
BmrFI CCNGG 1 cut(s) 205
BpuEI CTTGAG 1 cut(s) 169
BsaJI CCNNGG 1 cut(s) 204
Bse1I ACTGG 1 cut(s) 132
Bse3DI GCAATG 1 cut(s) 157
BseBI CCWGG 1 cut(s) 205
BseDI CCNNGG 1 cut(s) 204
BseMI GCAATG 1 cut(s) 157
BseMII CTCAG 2 cut(s) 5, 66
BseNI ACTGG 1 cut(s) 132
Bsp143I GATC 1 cut(s) 114
BspACI CCGC 1 cut(s) 243
BspCNI CTCAG 2 cut(s) 6, 67
BspLI GGNNCC 1 cut(s) 247
BspPI GGATC 1 cut(s) 122
BsrDI GCAATG 1 cut(s) 157
BsrI ACTGG 1 cut(s) 132
BssECI CCNNGG 1 cut(s) 204
BssMI GATC 1 cut(s) 114
Bst2UI CCWGG 1 cut(s) 205
BstDEI CTNAG 2 cut(s) 14, 75
BstKTI GATC 1 cut(s) 117
BstMBI GATC 1 cut(s) 114
BstMWI GCNNNNNNNGC 1 cut(s) 240
BstNI CCWGG 1 cut(s) 205
BstSCI CCNGG 1 cut(s) 203
BstSFI CTRYAG 1 cut(s) 229
Csp6I GTAC 1 cut(s) 72
CviAII CATG 1 cut(s) 191
CviJI RGCY 1 cut(s) 94
CviKI_1 RGCY 1 cut(s) 94
CviQI GTAC 1 cut(s) 72
DdeI CTNAG 2 cut(s) 14, 75
DpnI GATC 1 cut(s) 116
DpnII GATC 1 cut(s) 114
EciI GGCGGA 1 cut(s) 258
EcoRII CCWGG 1 cut(s) 203
FaeI CATG 1 cut(s) 194
FaiI YATR 4 cut(s) 102, 192, 231, 239
FatI CATG 1 cut(s) 190
FspBI CTAG 1 cut(s) 69
Hin1II CATG 1 cut(s) 194
HinfI GANTC 2 cut(s) 4, 153
Hpy188I TCNGA 1 cut(s) 119
Hpy188III TCNNGA 2 cut(s) 13, 148
HpyAV CCTTC 3 cut(s) 35, 74, 99
HpyCH4V TGCA 3 cut(s) 89, 162, 262
HpyF10VI GCNNNNNNNGC 1 cut(s) 240
HpyF3I CTNAG 2 cut(s) 14, 75
Hsp92II CATG 1 cut(s) 194
Kzo9I GATC 1 cut(s) 114
LpnPI CCDG 4 cut(s) 26, 113, 190, 217
MaeI CTAG 1 cut(s) 69
MaeIII GTNAC 1 cut(s) 199
MalI GATC 1 cut(s) 116
MboI GATC 1 cut(s) 114
MluCI AATT 1 cut(s) 121
MlyI GAGTC 2 cut(s) 13, 162
MnlI CCTC 2 cut(s) 39, 70
MspR9I CCNGG 1 cut(s) 205
MvaI CCWGG 1 cut(s) 205
MwoI GCNNNNNNNGC 1 cut(s) 240
NdeII GATC 1 cut(s) 114
NlaIII CATG 1 cut(s) 194
NlaIV GGNNCC 1 cut(s) 247
PleI GAGTC 2 cut(s) 12, 161
PpsI GAGTC 2 cut(s) 12, 161
Psp6I CCWGG 1 cut(s) 203
PspGI CCWGG 1 cut(s) 203
PspN4I GGNNCC 1 cut(s) 247
RsaI GTAC 1 cut(s) 73
RsaNI GTAC 1 cut(s) 72
Sau3AI GATC 1 cut(s) 114
ScaI AGTACT 1 cut(s) 73
SchI GAGTC 2 cut(s) 13, 162
ScrFI CCNGG 1 cut(s) 205
SetI ASST 2 cut(s) 27, 198
SfcI CTRYAG 1 cut(s) 229
SmlI CTYRAG 1 cut(s) 148
SmoI CTYRAG 1 cut(s) 148
SpeI ACTAGT 1 cut(s) 68
Sse9I AATT 1 cut(s) 121
SsiI CCGC 1 cut(s) 243
SspMI CTAG 1 cut(s) 69
StyD4I CCNGG 1 cut(s) 203
TaqI TCGA 2 cut(s) 59, 222
TasI AATT 1 cut(s) 121
TatI WGTACW 1 cut(s) 71
XapI RAATTY 1 cut(s) 121
XspI CTAG 1 cut(s) 69
ZrmI AGTACT 1 cut(s) 73
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.