RchiOBHm_Chr3g0492821

Thioredoxin

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Reverse (-)
39810926 .. 39815053
4128 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 225 bp
ATGACAGTGTTGAACATTTCAAGTCTGCCAATGTTTCATTTCTATCAAAATGGGGAAAAGGTAGAGGAGCTAGCTGGTGATTTTATCAGGCGCTTCAAGACAGTTCTTGAAACACTTTACAACCCTCAAAAAGTTGGCACAAAAGCCCAGGAAAATGTGATGCGTGAAGGCATTGTTGGAGGAAGGAACAAGGAGGAACAAATGATTGGCCTGGTGGACCAATAG

Protein Analysis

74

Amino Acids

8.47

Weight (kDa)

5.75

Isoelectric Point (pI)

35.93

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 4 cut(s) 13, 21, 97, 110
AjnI CCWGG 2 cut(s) 147, 210
AjuI GAANNNNNNNTTGG 4 cut(s) 159, 189, 191, 221
AluBI AGCT 2 cut(s) 70, 74
AluI AGCT 2 cut(s) 70, 74
AoxI GGCC 1 cut(s) 208
AspLEI GCGC 1 cut(s) 93
AspS9I GGNCC 1 cut(s) 217
AsuHPI GGTGA 1 cut(s) 89
AsuNHI GCTAGC 1 cut(s) 70
AvaII GGWCC 1 cut(s) 217
BciT130I CCWGG 2 cut(s) 149, 212
BfaI CTAG 1 cut(s) 71
BfoI RGCGCY 1 cut(s) 94
Bme1390I CCNGG 2 cut(s) 149, 212
Bme18I GGWCC 1 cut(s) 217
BmgT120I GGNCC 1 cut(s) 217
BmrFI CCNGG 2 cut(s) 149, 212
BmsI GCATC 1 cut(s) 150
BmtI GCTAGC 1 cut(s) 74
BsaJI CCNNGG 1 cut(s) 147
BseBI CCWGG 2 cut(s) 149, 212
BseDI CCNNGG 1 cut(s) 147
BseRI GAGGAG 1 cut(s) 80
BshFI GGCC 1 cut(s) 210
BsnI GGCC 1 cut(s) 210
BspANI GGCC 1 cut(s) 210
BspOI GCTAGC 1 cut(s) 74
BssECI CCNNGG 1 cut(s) 147
Bst2UI CCWGG 2 cut(s) 149, 212
Bst4CI ACNGT 2 cut(s) 7, 103
BstC8I GCNNGC 1 cut(s) 72
BstH2I RGCGCY 1 cut(s) 94
BstHHI GCGC 1 cut(s) 93
BstNI CCWGG 2 cut(s) 149, 212
BstSCI CCNGG 2 cut(s) 147, 210
BsuRI GGCC 1 cut(s) 210
BtsIMutI CAGTG 1 cut(s) 12
Cac8I GCNNGC 1 cut(s) 72
CfoI GCGC 1 cut(s) 93
Cfr13I GGNCC 1 cut(s) 217
CviJI RGCY 4 cut(s) 70, 74, 146, 210
CviKI_1 RGCY 4 cut(s) 70, 74, 146, 210
Eco47I GGWCC 1 cut(s) 217
EcoRII CCWGG 2 cut(s) 147, 210
FspBI CTAG 1 cut(s) 71
GlaI GCGC 1 cut(s) 92
HaeII RGCGCY 1 cut(s) 94
HaeIII GGCC 1 cut(s) 210
HhaI GCGC 1 cut(s) 93
Hin6I GCGC 1 cut(s) 91
HinP1I GCGC 1 cut(s) 91
HphI GGTGA 1 cut(s) 89
Hpy166II GTNNAC 1 cut(s) 217
Hpy188III TCNNGA 2 cut(s) 97, 107
Hpy8I GTNNAC 1 cut(s) 217
HpyAV CCTTC 2 cut(s) 161, 177
HpyCH4III ACNGT 2 cut(s) 7, 103
HspAI GCGC 1 cut(s) 91
LmnI GCTCC 1 cut(s) 67
LpnPI CCDG 5 cut(s) 60, 73, 134, 161, 197
LweI GCATC 1 cut(s) 150
MaeI CTAG 1 cut(s) 71
MmeI TCCRAC 1 cut(s) 157
MnlI CCTC 4 cut(s) 58, 135, 173, 187
MspR9I CCNGG 2 cut(s) 149, 212
MvaI CCWGG 2 cut(s) 149, 212
NheI GCTAGC 1 cut(s) 70
Psp6I CCWGG 2 cut(s) 147, 210
PspGI CCWGG 2 cut(s) 147, 210
PspPI GGNCC 1 cut(s) 217
Sau96I GGNCC 1 cut(s) 217
ScrFI CCNGG 2 cut(s) 149, 212
SetI ASST 3 cut(s) 63, 72, 76
SfaNI GCATC 1 cut(s) 150
SinI GGWCC 1 cut(s) 217
SspMI CTAG 1 cut(s) 71
StyD4I CCNGG 2 cut(s) 147, 210
TaaI ACNGT 2 cut(s) 7, 103
TscAI CASTG 1 cut(s) 12
TspDTI ATGAA 1 cut(s) 26
TspRI CASTG 1 cut(s) 12
VpaK11BI GGWCC 1 cut(s) 217
XspI CTAG 1 cut(s) 71
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.