Rw3G027000

Thioredoxin

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr3
Physical Location & Seq
Reverse (-)
37587426 .. 37589110
1685 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw3G027000.1

Sequence Viewer

Length: 156 bp
ATGGTTGTTGGATTTACTGATGATTTCACAATGACAGTGTTGAACATTTCAAGTCTGCCAATGTTTCATTTCTATCAAAATGGGGAAAAGGTAGAGGAGCTAGCTGGTGATTTTATCAGGCGCTTCAAGACAGTTCTTGAAACACTTTACAAGTAA

Protein Analysis

51

Amino Acids

5.98

Weight (kDa)

5.05

Isoelectric Point (pI)

32.25

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 4 cut(s) 43, 51, 127, 140
AluBI AGCT 2 cut(s) 100, 104
AluI AGCT 2 cut(s) 100, 104
AspLEI GCGC 1 cut(s) 123
AsuHPI GGTGA 1 cut(s) 119
AsuNHI GCTAGC 1 cut(s) 100
BfaI CTAG 1 cut(s) 101
BfoI RGCGCY 1 cut(s) 124
BmtI GCTAGC 1 cut(s) 104
BseRI GAGGAG 1 cut(s) 110
BspOI GCTAGC 1 cut(s) 104
Bst4CI ACNGT 2 cut(s) 37, 133
BstC8I GCNNGC 1 cut(s) 102
BstH2I RGCGCY 1 cut(s) 124
BstHHI GCGC 1 cut(s) 123
BtsIMutI CAGTG 1 cut(s) 42
Cac8I GCNNGC 1 cut(s) 102
CfoI GCGC 1 cut(s) 123
CviJI RGCY 2 cut(s) 100, 104
CviKI_1 RGCY 2 cut(s) 100, 104
FspBI CTAG 1 cut(s) 101
FspEI CC 8 cut(s) 66, 67, 68, 72, 74, 80, 90, 103
GlaI GCGC 1 cut(s) 122
HaeII RGCGCY 1 cut(s) 124
HhaI GCGC 1 cut(s) 123
Hin6I GCGC 1 cut(s) 121
HinP1I GCGC 1 cut(s) 121
HphI GGTGA 1 cut(s) 119
Hpy188III TCNNGA 2 cut(s) 127, 137
HpyCH4III ACNGT 2 cut(s) 37, 133
HspAI GCGC 1 cut(s) 121
LmnI GCTCC 1 cut(s) 97
LpnPI CCDG 2 cut(s) 90, 103
MaeI CTAG 1 cut(s) 101
MnlI CCTC 1 cut(s) 88
NheI GCTAGC 1 cut(s) 100
SetI ASST 3 cut(s) 93, 102, 106
SgeI CNNG 6 cut(s) 63, 113, 117, 130, 139, 149
SspMI CTAG 1 cut(s) 101
TaaI ACNGT 2 cut(s) 37, 133
TscAI CASTG 1 cut(s) 42
TspDTI ATGAA 1 cut(s) 56
TspRI CASTG 1 cut(s) 42
XspI CTAG 1 cut(s) 101
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.