RchiOBHm_Chr2g0108931
ERF Family

Metallo-beta-lactamase superfamily

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
20375087 .. 20375761
675 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 270 bp
ATGTACTTGGAAGCATTCATAACGAACCTTGAGTACCCTCCTGGTGTTGTGCTTGTACCTATGGGAAGCAGGACAAGAAAACCTTTTCATACAACAAACCTGGTTGTTTTTGCACCTAAAAATGTTCCAAATGATTCTGGAAAGAATGGTTTTATCGCGTGTGGAGATGCGTTGATAGTGGATCCTGGGTGTCAGTCTAAATTCCATGAAGAGGTCTGTTTAAGAGAAGAAACTCTTGTAAAAGAATTAGTGGTACAGATTTTATTGTGA

Protein Analysis

89

Amino Acids

9.86

Weight (kDa)

5.57

Isoelectric Point (pI)

40.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 158
AclWI GGATC 2 cut(s) 176, 189
AcsI RAATTY 1 cut(s) 200
AfaI GTAC 4 cut(s) 5, 35, 57, 255
AfiI CCNNNNNNNGG 1 cut(s) 211
AjnI CCWGG 3 cut(s) 40, 99, 184
AlwI GGATC 2 cut(s) 176, 189
ApoI RAATTY 1 cut(s) 200
BamHI GGATCC 1 cut(s) 181
BciT130I CCWGG 3 cut(s) 42, 101, 186
Bme1390I CCNGG 3 cut(s) 42, 101, 186
BmiI GGNNCC 1 cut(s) 183
BmrFI CCNGG 3 cut(s) 42, 101, 186
BmsI GCATC 1 cut(s) 157
BpuEI CTTGAG 1 cut(s) 50
BsaJI CCNNGG 1 cut(s) 185
Bsc4I CCNNNNNNNGG 1 cut(s) 211
BseBI CCWGG 3 cut(s) 42, 101, 186
BseDI CCNNGG 1 cut(s) 185
BseLI CCNNNNNNNGG 1 cut(s) 211
Bsh1236I CGCG 1 cut(s) 158
BslI CCNNNNNNNGG 1 cut(s) 211
BsmI GAATGC 1 cut(s) 14
Bsp143I GATC 1 cut(s) 181
BspFNI CGCG 1 cut(s) 158
BspLI GGNNCC 1 cut(s) 183
BspPI GGATC 2 cut(s) 176, 189
BssECI CCNNGG 1 cut(s) 185
BssMI GATC 1 cut(s) 181
Bst2UI CCWGG 3 cut(s) 42, 101, 186
Bst6I CTCTTC 1 cut(s) 204
BstFNI CGCG 1 cut(s) 158
BstKTI GATC 1 cut(s) 184
BstMBI GATC 1 cut(s) 181
BstNI CCWGG 3 cut(s) 42, 101, 186
BstSCI CCNGG 3 cut(s) 40, 99, 184
BstUI CGCG 1 cut(s) 158
BstX2I RGATCY 1 cut(s) 181
BstYI RGATCY 1 cut(s) 181
CsiI ACCWGGT 1 cut(s) 99
Csp6I GTAC 4 cut(s) 4, 34, 56, 254
CviAII CATG 1 cut(s) 206
CviQI GTAC 4 cut(s) 4, 34, 56, 254
DpnI GATC 1 cut(s) 183
DpnII GATC 1 cut(s) 181
Eam1104I CTCTTC 1 cut(s) 204
EarI CTCTTC 1 cut(s) 204
EcoRII CCWGG 3 cut(s) 40, 99, 184
FaeI CATG 1 cut(s) 209
FaiI YATR 4 cut(s) 20, 62, 90, 207
FalI AAGNNNNNCTT 4 cut(s) 67, 99, 219, 251
FatI CATG 1 cut(s) 205
Hin1II CATG 1 cut(s) 209
HinfI GANTC 1 cut(s) 134
Hpy188III TCNNGA 1 cut(s) 138
HpyCH4V TGCA 1 cut(s) 113
Hsp92II CATG 1 cut(s) 209
Kzo9I GATC 1 cut(s) 181
LpnPI CCDG 8 cut(s) 27, 54, 55, 86, 113, 123, 171, 198
LweI GCATC 1 cut(s) 157
MabI ACCWGGT 1 cut(s) 99
MalI GATC 1 cut(s) 183
MboI GATC 1 cut(s) 181
MboII GAAGA 2 cut(s) 221, 239
MflI RGATCY 1 cut(s) 181
MluCI AATT 2 cut(s) 200, 245
MnlI CCTC 2 cut(s) 48, 205
MseI TTAA 1 cut(s) 221
MspR9I CCNGG 3 cut(s) 42, 101, 186
Mva1269I GAATGC 1 cut(s) 14
MvaI CCWGG 3 cut(s) 42, 101, 186
MvnI CGCG 1 cut(s) 158
NdeII GATC 1 cut(s) 181
NlaIII CATG 1 cut(s) 209
NlaIV GGNNCC 1 cut(s) 183
PctI GAATGC 1 cut(s) 14
PfeI GAWTC 1 cut(s) 134
Psp6I CCWGG 3 cut(s) 40, 99, 184
PspGI CCWGG 3 cut(s) 40, 99, 184
PspN4I GGNNCC 1 cut(s) 183
PsrI GAACNNNNNNTAC 2 cut(s) 17, 49
PsuI RGATCY 1 cut(s) 181
RsaI GTAC 4 cut(s) 5, 35, 57, 255
RsaNI GTAC 4 cut(s) 4, 34, 56, 254
SaqAI TTAA 1 cut(s) 221
Sau3AI GATC 1 cut(s) 181
ScrFI CCNGG 3 cut(s) 42, 101, 186
SetI ASST 6 cut(s) 30, 61, 85, 102, 118, 216
SexAI ACCWGGT 1 cut(s) 99
SfaNI GCATC 1 cut(s) 157
SmlI CTYRAG 1 cut(s) 29
SmoI CTYRAG 1 cut(s) 29
Sse9I AATT 2 cut(s) 200, 245
StyD4I CCNGG 3 cut(s) 40, 99, 184
TasI AATT 2 cut(s) 200, 245
TatI WGTACW 1 cut(s) 3
TfiI GAWTC 1 cut(s) 134
Tru1I TTAA 1 cut(s) 221
Tru9I TTAA 1 cut(s) 221
TspDTI ATGAA 3 cut(s) 7, 77, 222
XapI RAATTY 1 cut(s) 200
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.