RCHIOBHM_CHR0C22G0500581

Hsp90 protein

Basic Information

Type: Sequence Only
Biological Identity
rosa_chinensis
Unknown
Physical Location & Seq
Reverse (-)
0 .. 0
1 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 141 bp
ATGGAAGCCTTGGCTACTAGATCTGATGTTAGCATGATTGGTCAGTTTGGTGTTGGATTCTACTTTGCATATCATGTTGTTGAGAAGGAAGAGGAAGTTGATGAAGAGAAGGAAGTGGCAGGGTTAGTATGTTCATGTTAA

Protein Analysis

46

Amino Acids

5.1

Weight (kDa)

4.22

Isoelectric Point (pI)

50.7

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
BfaI CTAG 1 cut(s) 18
BglII AGATCT 1 cut(s) 20
BsaJI CCNNGG 1 cut(s) 9
BseDI CCNNGG 1 cut(s) 9
Bsp143I GATC 1 cut(s) 20
BssECI CCNNGG 1 cut(s) 9
BssMI GATC 1 cut(s) 20
BssT1I CCWWGG 1 cut(s) 9
Bst6I CTCTTC 2 cut(s) 84, 99
BstKTI GATC 1 cut(s) 23
BstMBI GATC 1 cut(s) 20
BstX2I RGATCY 1 cut(s) 20
BstYI RGATCY 1 cut(s) 20
CviAII CATG 3 cut(s) 34, 74, 135
CviJI RGCY 2 cut(s) 8, 14
CviKI_1 RGCY 2 cut(s) 8, 14
DpnI GATC 1 cut(s) 22
DpnII GATC 1 cut(s) 20
Eam1104I CTCTTC 2 cut(s) 84, 99
EarI CTCTTC 2 cut(s) 84, 99
Eco130I CCWWGG 1 cut(s) 9
EcoT14I CCWWGG 1 cut(s) 9
ErhI CCWWGG 1 cut(s) 9
FaeI CATG 3 cut(s) 37, 77, 138
FaiI YATR 5 cut(s) 35, 70, 75, 130, 136
FatI CATG 3 cut(s) 33, 73, 134
FspBI CTAG 1 cut(s) 18
Hin1II CATG 3 cut(s) 37, 77, 138
HinfI GANTC 1 cut(s) 57
Hpy188I TCNGA 1 cut(s) 25
HpyAV CCTTC 2 cut(s) 79, 103
HpyCH4V TGCA 1 cut(s) 68
Hsp92II CATG 3 cut(s) 37, 77, 138
Kzo9I GATC 1 cut(s) 20
LpnPI CCDG 1 cut(s) 105
MaeI CTAG 1 cut(s) 18
MalI GATC 1 cut(s) 22
MboI GATC 1 cut(s) 20
MboII GAAGA 2 cut(s) 101, 116
MflI RGATCY 1 cut(s) 20
MmeI TCCRAC 1 cut(s) 34
MnlI CCTC 1 cut(s) 85
MseI TTAA 1 cut(s) 139
NdeII GATC 1 cut(s) 20
NlaIII CATG 3 cut(s) 37, 77, 138
PfeI GAWTC 1 cut(s) 57
PsuI RGATCY 1 cut(s) 20
SaqAI TTAA 1 cut(s) 139
Sau3AI GATC 1 cut(s) 20
SgeI CNNG 5 cut(s) 22, 30, 46, 86, 132
SspMI CTAG 1 cut(s) 18
StyI CCWWGG 1 cut(s) 9
TfiI GAWTC 1 cut(s) 57
Tru1I TTAA 1 cut(s) 139
Tru9I TTAA 1 cut(s) 139
TspDTI ATGAA 2 cut(s) 117, 123
XspI CTAG 1 cut(s) 18
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.