RchiOBHm_Chr4g0400001

Hsp90 protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Forward (+)
17559245 .. 17561827
2583 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ37208

Sequence Viewer

Length: 162 bp
ATGGAAGCCTTGGATGCTGGAGCTGATCTTAGCATGATTGGTCAGTTTGATGTTGGGTTCTACTCTGCATATCTTGTTACTGAGAAGGAAGAGGAAGGAATTCTAAAAATAATAATGTTGCTACGCTTATATAGCCTTTACATTTTTGGCCTTTATGTTTAG

Protein Analysis

53

Amino Acids

6.01

Weight (kDa)

4.12

Isoelectric Point (pI)

28.86

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 99
AluBI AGCT 1 cut(s) 23
AluI AGCT 1 cut(s) 23
AoxI GGCC 1 cut(s) 148
ApoI RAATTY 1 cut(s) 99
Asp700I GAANNNNTTC 1 cut(s) 99
BmsI GCATC 1 cut(s) 4
BpmI CTGGAG 1 cut(s) 39
BsaJI CCNNGG 1 cut(s) 9
BseDI CCNNGG 1 cut(s) 9
BseGI GGATG 1 cut(s) 19
BseMII CTCAG 1 cut(s) 72
BshFI GGCC 1 cut(s) 150
BsnI GGCC 1 cut(s) 150
Bsp143I GATC 1 cut(s) 25
BspANI GGCC 1 cut(s) 150
BspCNI CTCAG 1 cut(s) 73
BssECI CCNNGG 1 cut(s) 9
BssMI GATC 1 cut(s) 25
BssT1I CCWWGG 1 cut(s) 9
Bst6I CTCTTC 1 cut(s) 84
BstDEI CTNAG 2 cut(s) 29, 81
BstF5I GGATG 1 cut(s) 19
BstKTI GATC 1 cut(s) 28
BstMBI GATC 1 cut(s) 25
BstMWI GCNNNNNNNGC 2 cut(s) 14, 132
BsuRI GGCC 1 cut(s) 150
BtsCI GGATG 1 cut(s) 19
CviAII CATG 1 cut(s) 34
CviJI RGCY 4 cut(s) 8, 23, 135, 150
CviKI_1 RGCY 4 cut(s) 8, 23, 135, 150
DdeI CTNAG 2 cut(s) 29, 81
DpnI GATC 1 cut(s) 27
DpnII GATC 1 cut(s) 25
Eam1104I CTCTTC 1 cut(s) 84
EarI CTCTTC 1 cut(s) 84
Eco130I CCWWGG 1 cut(s) 9
EcoRI GAATTC 1 cut(s) 99
EcoT14I CCWWGG 1 cut(s) 9
ErhI CCWWGG 1 cut(s) 9
FaeI CATG 1 cut(s) 37
FaiI YATR 5 cut(s) 35, 70, 130, 132, 156
FatI CATG 1 cut(s) 33
FokI GGATG 1 cut(s) 26
GsuI CTGGAG 1 cut(s) 39
HaeIII GGCC 1 cut(s) 150
Hin1II CATG 1 cut(s) 37
HpyAV CCTTC 2 cut(s) 79, 89
HpyCH4V TGCA 1 cut(s) 68
HpyF10VI GCNNNNNNNGC 2 cut(s) 14, 132
HpyF3I CTNAG 2 cut(s) 29, 81
Hsp92II CATG 1 cut(s) 37
Kzo9I GATC 1 cut(s) 25
LmnI GCTCC 1 cut(s) 20
LpnPI CCDG 1 cut(s) 3
LweI GCATC 1 cut(s) 4
MaeIII GTNAC 1 cut(s) 76
MalI GATC 1 cut(s) 27
MboI GATC 1 cut(s) 25
MboII GAAGA 1 cut(s) 101
MluCI AATT 1 cut(s) 99
MnlI CCTC 1 cut(s) 85
MroXI GAANNNNTTC 1 cut(s) 99
MwoI GCNNNNNNNGC 2 cut(s) 14, 132
NdeII GATC 1 cut(s) 25
NlaIII CATG 1 cut(s) 37
PdmI GAANNNNTTC 1 cut(s) 99
Sau3AI GATC 1 cut(s) 25
SetI ASST 1 cut(s) 25
SfaNI GCATC 1 cut(s) 4
SgeI CNNG 4 cut(s) 22, 30, 46, 86
Sse9I AATT 1 cut(s) 99
StyI CCWWGG 1 cut(s) 9
TasI AATT 1 cut(s) 99
XapI RAATTY 1 cut(s) 99
XmnI GAANNNNTTC 1 cut(s) 99
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.