RchiOBHm_Chr7g0206671

Hsp90 protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Forward (+)
24263926 .. 24266447
2522 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ18497

Sequence Viewer

Length: 168 bp
ATGGAAGCCTTGGCTACTAGATCTGATGTTAGCATGATTGGTCAGTTTGGTGTTGGATTCTACTTTGCATATCATGTTGTTGAGAAGGAAGAGGAAGTTGATGAAGAGAAGGAAGTGGTCATGTTTCTGGCCTTGATTTTTTTGACATTTATGTTTAGGCAGGGTTAG

Protein Analysis

55

Amino Acids

6.39

Weight (kDa)

4.39

Isoelectric Point (pI)

43.86

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AoxI GGCC 1 cut(s) 129
BfaI CTAG 1 cut(s) 18
BglII AGATCT 1 cut(s) 20
BsaJI CCNNGG 1 cut(s) 9
BseDI CCNNGG 1 cut(s) 9
BshFI GGCC 1 cut(s) 131
BsnI GGCC 1 cut(s) 131
Bsp143I GATC 1 cut(s) 20
BspANI GGCC 1 cut(s) 131
BssECI CCNNGG 1 cut(s) 9
BssMI GATC 1 cut(s) 20
BssT1I CCWWGG 1 cut(s) 9
Bst6I CTCTTC 2 cut(s) 84, 99
BstKTI GATC 1 cut(s) 23
BstMBI GATC 1 cut(s) 20
BstX2I RGATCY 1 cut(s) 20
BstYI RGATCY 1 cut(s) 20
BsuRI GGCC 1 cut(s) 131
CviAII CATG 3 cut(s) 34, 74, 121
CviJI RGCY 3 cut(s) 8, 14, 131
CviKI_1 RGCY 3 cut(s) 8, 14, 131
DpnI GATC 1 cut(s) 22
DpnII GATC 1 cut(s) 20
Eam1104I CTCTTC 2 cut(s) 84, 99
EarI CTCTTC 2 cut(s) 84, 99
Eco130I CCWWGG 1 cut(s) 9
EcoT14I CCWWGG 1 cut(s) 9
ErhI CCWWGG 1 cut(s) 9
FaeI CATG 3 cut(s) 37, 77, 124
FaiI YATR 5 cut(s) 35, 70, 75, 122, 152
FatI CATG 3 cut(s) 33, 73, 120
FspBI CTAG 1 cut(s) 18
HaeIII GGCC 1 cut(s) 131
Hin1II CATG 3 cut(s) 37, 77, 124
HinfI GANTC 1 cut(s) 57
Hpy188I TCNGA 1 cut(s) 25
HpyAV CCTTC 2 cut(s) 79, 103
HpyCH4V TGCA 1 cut(s) 68
Hsp92II CATG 3 cut(s) 37, 77, 124
Kzo9I GATC 1 cut(s) 20
LpnPI CCDG 2 cut(s) 113, 146
MaeI CTAG 1 cut(s) 18
MalI GATC 1 cut(s) 22
MboI GATC 1 cut(s) 20
MboII GAAGA 2 cut(s) 101, 116
MflI RGATCY 1 cut(s) 20
MmeI TCCRAC 1 cut(s) 34
MnlI CCTC 1 cut(s) 85
NdeII GATC 1 cut(s) 20
NlaIII CATG 3 cut(s) 37, 77, 124
PfeI GAWTC 1 cut(s) 57
PsuI RGATCY 1 cut(s) 20
Sau3AI GATC 1 cut(s) 20
SgeI CNNG 7 cut(s) 22, 30, 46, 86, 133, 140, 145
SspMI CTAG 1 cut(s) 18
StyI CCWWGG 1 cut(s) 9
TfiI GAWTC 1 cut(s) 57
TspDTI ATGAA 1 cut(s) 117
XspI CTAG 1 cut(s) 18
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.