Rmu_sc0002040.1_g000047

UNC93-like protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002040.1
Physical Location & Seq
Reverse (-)
200329 .. 201000
672 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002040.1_g000047.1.cds

Sequence Viewer

Length: 339 bp
atgcagaagatgaaggtgtcggagatggcggaggcgaacttgttgtactgcactgacgagggggagctgtgctgggccagtgataagaagtactacagaggaggatttgggaacaatatcatgtctgtgtttctgttgatcttttttgcttacgatgctgctcaaaatctggagagcactatcaacactgaggaggatttgggaacaacgtcgcttgagattttgtacttgtctccaatggttaggaaactaggaccaaagaatgctttgattcttaggactactggatattggttgttcattgctactaatttgaagccaacttggtacttttactaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

112

Amino Acids

12.91

Weight (kDa)

5.05

Isoelectric Point (pI)

38.98

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 29
AfaI GTAC 4 cut(s) 47, 92, 227, 329
AgsI TTSAA 1 cut(s) 316
AluBI AGCT 1 cut(s) 67
AluI AGCT 1 cut(s) 67
Alw21I GWGCWC 1 cut(s) 179
Alw26I GTCTC 1 cut(s) 237
AoxI GGCC 1 cut(s) 75
ApeKI GCWGC 1 cut(s) 158
AspS9I GGNCC 2 cut(s) 75, 254
AvaII GGWCC 1 cut(s) 254
Bbv12I GWGCWC 1 cut(s) 179
BbvI GCAGC 1 cut(s) 145
BccI CCATC 1 cut(s) 19
BcoDI GTCTC 1 cut(s) 237
BfaI CTAG 1 cut(s) 251
BfmI CTRYAG 1 cut(s) 94
BisI GCNGC 1 cut(s) 159
BlsI GCNGC 1 cut(s) 160
BmcAI AGTACT 1 cut(s) 92
Bme18I GGWCC 1 cut(s) 254
BmgT120I GGNCC 2 cut(s) 75, 254
BmsI GCATC 1 cut(s) 145
BpmI CTGGAG 1 cut(s) 191
BpuEI CTTGAG 1 cut(s) 236
Bse1I ACTGG 2 cut(s) 78, 289
Bse3DI GCAATG 1 cut(s) 300
BseMI GCAATG 1 cut(s) 300
BseMII CTCAG 1 cut(s) 180
BseNI ACTGG 2 cut(s) 78, 289
BseRI GAGGAG 2 cut(s) 114, 206
BseXI GCAGC 1 cut(s) 145
BseYI CCCAGC 1 cut(s) 72
BsgI GTGCAG 1 cut(s) 34
BshFI GGCC 1 cut(s) 77
BsiHKAI GWGCWC 1 cut(s) 179
BsmAI GTCTC 1 cut(s) 237
BsmI GAATGC 1 cut(s) 268
BsnI GGCC 1 cut(s) 77
Bsp1286I GDGCHC 1 cut(s) 179
Bsp143I GATC 1 cut(s) 138
BspACI CCGC 1 cut(s) 29
BspANI GGCC 1 cut(s) 77
BspCNI CTCAG 1 cut(s) 181
BsrDI GCAATG 1 cut(s) 300
BsrI ACTGG 2 cut(s) 78, 289
BssMI GATC 1 cut(s) 138
BstDEI CTNAG 2 cut(s) 189, 275
BstKTI GATC 1 cut(s) 141
BstMAI GTCTC 1 cut(s) 237
BstMBI GATC 1 cut(s) 138
BstMWI GCNNNNNNNGC 1 cut(s) 155
BstSFI CTRYAG 1 cut(s) 94
BstV1I GCAGC 1 cut(s) 145
BsuRI GGCC 1 cut(s) 77
BtsIMutI CAGTG 3 cut(s) 51, 85, 186
Cfr13I GGNCC 2 cut(s) 75, 254
Csp6I GTAC 4 cut(s) 46, 91, 226, 328
CviAII CATG 1 cut(s) 121
CviJI RGCY 3 cut(s) 67, 77, 319
CviKI_1 RGCY 3 cut(s) 67, 77, 319
CviQI GTAC 4 cut(s) 46, 91, 226, 328
DdeI CTNAG 2 cut(s) 189, 275
DpnI GATC 1 cut(s) 140
DpnII GATC 1 cut(s) 138
EciI GGCGGA 1 cut(s) 44
Eco47I GGWCC 1 cut(s) 254
FaeI CATG 1 cut(s) 124
FaiI YATR 1 cut(s) 122
FatI CATG 1 cut(s) 120
Fnu4HI GCNGC 1 cut(s) 159
Fsp4HI GCNGC 1 cut(s) 159
FspBI CTAG 1 cut(s) 251
GluI GCNGC 1 cut(s) 159
GsaI CCCAGC 1 cut(s) 76
GsuI CTGGAG 1 cut(s) 191
HaeIII GGCC 1 cut(s) 77
Hin1II CATG 1 cut(s) 124
HinfI GANTC 1 cut(s) 271
Hpy188I TCNGA 1 cut(s) 22
Hpy188III TCNNGA 1 cut(s) 170
Hpy99I CGWCG 1 cut(s) 214
HpyAV CCTTC 1 cut(s) 7
HpyCH4IV ACGT 1 cut(s) 209
HpyCH4V TGCA 2 cut(s) 4, 51
HpyF10VI GCNNNNNNNGC 1 cut(s) 155
HpyF3I CTNAG 2 cut(s) 189, 275
HpySE526I ACGT 1 cut(s) 209
Hsp92II CATG 1 cut(s) 124
Kzo9I GATC 1 cut(s) 138
LmnI GCTCC 1 cut(s) 64
LpnPI CCDG 4 cut(s) 58, 91, 155, 270
Lsp1109I GCAGC 1 cut(s) 145
LweI GCATC 1 cut(s) 145
MaeI CTAG 1 cut(s) 251
MaeII ACGT 1 cut(s) 209
MalI GATC 1 cut(s) 140
MboI GATC 1 cut(s) 138
MboII GAAGA 1 cut(s) 19
MhlI GDGCHC 1 cut(s) 179
MluCI AATT 1 cut(s) 310
MnlI CCTC 6 cut(s) 25, 52, 92, 95, 184, 187
MslI CAYNNNNRTG 1 cut(s) 125
Mva1269I GAATGC 1 cut(s) 268
MwoI GCNNNNNNNGC 1 cut(s) 155
NdeII GATC 1 cut(s) 138
NlaIII CATG 1 cut(s) 124
PctI GAATGC 1 cut(s) 268
PfeI GAWTC 1 cut(s) 271
PkrI GCNGC 1 cut(s) 160
PspFI CCCAGC 1 cut(s) 72
PspPI GGNCC 2 cut(s) 75, 254
PsrI GAACNNNNNNTAC 2 cut(s) 29, 61
RsaI GTAC 4 cut(s) 47, 92, 227, 329
RsaNI GTAC 4 cut(s) 46, 91, 226, 328
RseI CAYNNNNRTG 1 cut(s) 125
SatI GCNGC 1 cut(s) 159
Sau3AI GATC 1 cut(s) 138
Sau96I GGNCC 2 cut(s) 75, 254
ScaI AGTACT 1 cut(s) 92
SduI GDGCHC 1 cut(s) 179
SetI ASST 3 cut(s) 18, 69, 212
SfaNI GCATC 1 cut(s) 145
SfcI CTRYAG 1 cut(s) 94
SinI GGWCC 1 cut(s) 254
SmiMI CAYNNNNRTG 1 cut(s) 125
SmlI CTYRAG 1 cut(s) 215
SmoI CTYRAG 1 cut(s) 215
Sse9I AATT 1 cut(s) 310
SsiI CCGC 1 cut(s) 29
SspMI CTAG 1 cut(s) 251
TaiI ACGT 1 cut(s) 212
TasI AATT 1 cut(s) 310
TatI WGTACW 3 cut(s) 45, 90, 225
TfiI GAWTC 1 cut(s) 271
TscAI CASTG 3 cut(s) 58, 85, 193
TseI GCWGC 1 cut(s) 158
TspDTI ATGAA 2 cut(s) 26, 289
TspRI CASTG 3 cut(s) 58, 85, 193
VpaK11BI GGWCC 1 cut(s) 254
XspI CTAG 1 cut(s) 251
ZrmI AGTACT 1 cut(s) 92
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.