RchiOBHm_Chr1g0323891

Regulatory subunit of the dimeric E1 enzyme. E1 activates RUB1 NEDD8 by first adenylating its C-terminal glycine residue with ATP, thereafter linking this residue to the side chain of the catalytic cysteine, yielding a RUB1-ECR1 thioester and free AMP. E1 finally transfers RUB1 to the catalytic cysteine of RCE1

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Forward (+)
11379248 .. 11380938
1691 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ55375

Sequence Viewer

Length: 264 bp
ATGTTGTTATCTGAGACATTATCAATGTCAGTCTCTTTTGCATTTCTGATAAAAAGTCCTAGTAGTGTACTTCCAACAACTAGGGAAGAGAAAAAAGAGTTCAAGGAATTCCTAGCAAATGAAGGTGGTGGTGAGGCACCCCTCGAGGGATCAGTACCAGATATAACATCTTCAACTGAGCACTATGTAGCTTTACAGAAAACCTACCAAGCCAAGGCTGAGGCTGATTTTCTAGTATTGACCAAAGGGTTAGGACTCTTCTAA

Protein Analysis

87

Amino Acids

9.46

Weight (kDa)

4.87

Isoelectric Point (pI)

44.96

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AbsI CCTCGAGG 1 cut(s) 143
AccB1I GGYRCC 1 cut(s) 136
AclWI GGATC 1 cut(s) 157
AcsI RAATTY 1 cut(s) 107
AfaI GTAC 2 cut(s) 69, 156
AfiI CCNNNNNNNGG 2 cut(s) 146, 214
AgsI TTSAA 2 cut(s) 103, 174
AluBI AGCT 1 cut(s) 191
AluI AGCT 1 cut(s) 191
Alw21I GWGCWC 1 cut(s) 183
Alw26I GTCTC 2 cut(s) 8, 37
AlwI GGATC 1 cut(s) 157
Ama87I CYCGRG 1 cut(s) 143
ApoI RAATTY 1 cut(s) 107
AsuHPI GGTGA 1 cut(s) 143
AvaI CYCGRG 1 cut(s) 143
BanI GGYRCC 1 cut(s) 136
Bbv12I GWGCWC 1 cut(s) 183
BbvCI CCTCAGC 1 cut(s) 219
BcoDI GTCTC 2 cut(s) 8, 37
BfaI CTAG 4 cut(s) 60, 81, 113, 233
BmeT110I CYCGRG 1 cut(s) 143
BmiI GGNNCC 1 cut(s) 138
Bpu10I CCTNAGC 1 cut(s) 219
BsaJI CCNNGG 1 cut(s) 213
Bsc4I CCNNNNNNNGG 2 cut(s) 146, 214
BseDI CCNNGG 1 cut(s) 213
BseLI CCNNNNNNNGG 2 cut(s) 146, 214
BseMII CTCAG 2 cut(s) 168, 210
BshNI GGYRCC 1 cut(s) 136
BsiHKAI GWGCWC 1 cut(s) 183
BsiHKCI CYCGRG 1 cut(s) 143
BslI CCNNNNNNNGG 2 cut(s) 146, 214
BsmAI GTCTC 2 cut(s) 8, 37
BsoBI CYCGRG 1 cut(s) 143
Bsp1286I GDGCHC 1 cut(s) 183
Bsp143I GATC 1 cut(s) 149
BspCNI CTCAG 3 cut(s) 4, 169, 211
BspLI GGNNCC 1 cut(s) 138
BspPI GGATC 1 cut(s) 157
BspT107I GGYRCC 1 cut(s) 136
BssECI CCNNGG 1 cut(s) 213
BssMI GATC 1 cut(s) 149
BssT1I CCWWGG 1 cut(s) 213
Bst6I CTCTTC 1 cut(s) 81
BstDEI CTNAG 3 cut(s) 12, 177, 219
BstKTI GATC 1 cut(s) 152
BstMAI GTCTC 2 cut(s) 8, 37
BstMBI GATC 1 cut(s) 149
Csp6I GTAC 2 cut(s) 68, 155
CviJI RGCY 4 cut(s) 191, 212, 218, 224
CviKI_1 RGCY 4 cut(s) 191, 212, 218, 224
CviQI GTAC 2 cut(s) 68, 155
DdeI CTNAG 3 cut(s) 12, 177, 219
DpnI GATC 1 cut(s) 151
DpnII GATC 1 cut(s) 149
Eam1104I CTCTTC 1 cut(s) 81
EarI CTCTTC 1 cut(s) 81
Eco130I CCWWGG 1 cut(s) 213
Eco88I CYCGRG 1 cut(s) 143
EcoRI GAATTC 1 cut(s) 107
EcoT14I CCWWGG 1 cut(s) 213
ErhI CCWWGG 1 cut(s) 213
FaiI YATR 2 cut(s) 164, 186
FspBI CTAG 4 cut(s) 60, 81, 113, 233
HinfI GANTC 1 cut(s) 255
HphI GGTGA 1 cut(s) 143
Hpy166II GTNNAC 1 cut(s) 68
Hpy188I TCNGA 2 cut(s) 13, 48
Hpy8I GTNNAC 1 cut(s) 68
HpyAV CCTTC 1 cut(s) 116
HpyCH4V TGCA 1 cut(s) 41
HpyF3I CTNAG 3 cut(s) 12, 177, 219
Kzo9I GATC 1 cut(s) 149
LpnPI CCDG 1 cut(s) 171
MaeI CTAG 4 cut(s) 60, 81, 113, 233
MalI GATC 1 cut(s) 151
MboI GATC 1 cut(s) 149
MboII GAAGA 3 cut(s) 98, 162, 250
MhlI GDGCHC 1 cut(s) 183
MluCI AATT 1 cut(s) 107
MlyI GAGTC 1 cut(s) 249
MmeI TCCRAC 1 cut(s) 98
MnlI CCTC 4 cut(s) 127, 139, 152, 214
NdeII GATC 1 cut(s) 149
NlaIV GGNNCC 1 cut(s) 138
PaeR7I CTCGAG 1 cut(s) 143
PleI GAGTC 1 cut(s) 249
PpsI GAGTC 1 cut(s) 249
PspN4I GGNNCC 1 cut(s) 138
PspXI VCTCGAGB 1 cut(s) 143
RsaI GTAC 2 cut(s) 69, 156
RsaNI GTAC 2 cut(s) 68, 155
Sau3AI GATC 1 cut(s) 149
SchI GAGTC 1 cut(s) 249
SduI GDGCHC 1 cut(s) 183
SetI ASST 3 cut(s) 127, 193, 206
Sfr274I CTCGAG 1 cut(s) 143
SlaI CTCGAG 1 cut(s) 143
SmlI CTYRAG 1 cut(s) 143
SmoI CTYRAG 1 cut(s) 143
Sse9I AATT 1 cut(s) 107
SspMI CTAG 4 cut(s) 60, 81, 113, 233
StyI CCWWGG 1 cut(s) 213
TaqI TCGA 1 cut(s) 144
TasI AATT 1 cut(s) 107
TatI WGTACW 1 cut(s) 67
TspDTI ATGAA 1 cut(s) 135
XapI RAATTY 1 cut(s) 107
XhoI CTCGAG 1 cut(s) 143
XspI CTAG 4 cut(s) 60, 81, 113, 233
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.