Rh3CG300400

Regulatory subunit of the dimeric E1 enzyme. E1 activates RUB1 NEDD8 by first adenylating its C-terminal glycine residue with ATP, thereafter linking this residue to the side chain of the catalytic cysteine, yielding a RUB1-ECR1 thioester and free AMP. E1 finally transfers RUB1 to the catalytic cysteine of RCE1

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3C
Physical Location & Seq
Forward (+)
31089017 .. 31092605
3589 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3CG300400.1

Sequence Viewer

Length: 210 bp
ATGGAGGTTTGGGTACAAATATGGGATTCGGTGATCAAGTTCAATGGAGGTTTGGGTACAAATATTGGATTCGGTGGCCCCAAGTATGAAGAATTCCTAGCAAATGAAGGTGGTGGTGAGGCACCCCTTGAGGGATCAATACCAGATATAACATCTTCAACTGAGTTAGTCGACATCCCCAGAATTTCATGTTTCTCTTTTGTGCTTTAA

Protein Analysis

69

Amino Acids

7.44

Weight (kDa)

4.05

Isoelectric Point (pI)

28.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 121
AccI GTMKAC 1 cut(s) 171
AclWI GGATC 1 cut(s) 142
AcsI RAATTY 2 cut(s) 92, 183
AfaI GTAC 2 cut(s) 15, 58
AfiI CCNNNNNNNGG 1 cut(s) 131
AgsI TTSAA 2 cut(s) 43, 159
AlwI GGATC 1 cut(s) 142
AoxI GGCC 1 cut(s) 76
ApoI RAATTY 2 cut(s) 92, 183
AspS9I GGNCC 1 cut(s) 77
AsuHPI GGTGA 2 cut(s) 43, 128
BanI GGYRCC 1 cut(s) 121
BclI TGATCA 1 cut(s) 33
BfaI CTAG 1 cut(s) 98
BmgT120I GGNCC 1 cut(s) 77
BmiI GGNNCC 2 cut(s) 79, 123
BpuEI CTTGAG 1 cut(s) 149
Bsc4I CCNNNNNNNGG 1 cut(s) 131
BseGI GGATG 1 cut(s) 174
BseLI CCNNNNNNNGG 1 cut(s) 131
BseMII CTCAG 1 cut(s) 153
BshFI GGCC 1 cut(s) 78
BshNI GGYRCC 1 cut(s) 121
BslI CCNNNNNNNGG 1 cut(s) 131
BsnI GGCC 1 cut(s) 78
Bsp143I GATC 2 cut(s) 33, 134
BspANI GGCC 1 cut(s) 78
BspCNI CTCAG 1 cut(s) 154
BspLI GGNNCC 2 cut(s) 79, 123
BspPI GGATC 1 cut(s) 142
BspT107I GGYRCC 1 cut(s) 121
BssMI GATC 2 cut(s) 33, 134
BstDEI CTNAG 1 cut(s) 162
BstF5I GGATG 1 cut(s) 174
BstKTI GATC 2 cut(s) 36, 137
BstMBI GATC 2 cut(s) 33, 134
BsuRI GGCC 1 cut(s) 78
BtsCI GGATG 1 cut(s) 174
Cfr13I GGNCC 1 cut(s) 77
Csp6I GTAC 2 cut(s) 14, 57
CviAII CATG 1 cut(s) 189
CviJI RGCY 1 cut(s) 78
CviKI_1 RGCY 1 cut(s) 78
CviQI GTAC 2 cut(s) 14, 57
DdeI CTNAG 1 cut(s) 162
DpnI GATC 2 cut(s) 35, 136
DpnII GATC 2 cut(s) 33, 134
EcoRI GAATTC 1 cut(s) 92
FaeI CATG 1 cut(s) 192
FaiI YATR 4 cut(s) 22, 87, 149, 190
FatI CATG 1 cut(s) 188
FbaI TGATCA 1 cut(s) 33
FblI GTMKAC 1 cut(s) 171
FokI GGATG 1 cut(s) 161
FspBI CTAG 1 cut(s) 98
HaeIII GGCC 1 cut(s) 78
Hin1II CATG 1 cut(s) 192
HincII GTYRAC 1 cut(s) 172
HindII GTYRAC 1 cut(s) 172
HinfI GANTC 2 cut(s) 26, 69
HphI GGTGA 2 cut(s) 43, 128
Hpy166II GTNNAC 1 cut(s) 172
Hpy8I GTNNAC 1 cut(s) 172
HpyAV CCTTC 1 cut(s) 101
HpyF3I CTNAG 1 cut(s) 162
Hsp92II CATG 1 cut(s) 192
Ksp22I TGATCA 1 cut(s) 33
Kzo9I GATC 2 cut(s) 33, 134
LpnPI CCDG 2 cut(s) 156, 193
MaeI CTAG 1 cut(s) 98
MalI GATC 2 cut(s) 35, 136
MboI GATC 2 cut(s) 33, 134
MboII GAAGA 2 cut(s) 101, 147
MluCI AATT 2 cut(s) 92, 183
MnlI CCTC 3 cut(s) 41, 112, 124
MseI TTAA 1 cut(s) 208
NdeII GATC 2 cut(s) 33, 134
NlaIII CATG 1 cut(s) 192
NlaIV GGNNCC 2 cut(s) 79, 123
PfeI GAWTC 2 cut(s) 26, 69
PspN4I GGNNCC 2 cut(s) 79, 123
PspPI GGNCC 1 cut(s) 77
RsaI GTAC 2 cut(s) 15, 58
RsaNI GTAC 2 cut(s) 14, 57
SalI GTCGAC 1 cut(s) 170
SaqAI TTAA 1 cut(s) 208
Sau3AI GATC 2 cut(s) 33, 134
Sau96I GGNCC 1 cut(s) 77
SetI ASST 3 cut(s) 9, 52, 112
SgeI CNNG 7 cut(s) 49, 94, 110, 140, 155, 192, 201
SmlI CTYRAG 1 cut(s) 128
SmoI CTYRAG 1 cut(s) 128
Sse9I AATT 2 cut(s) 92, 183
SspI AATATT 1 cut(s) 64
SspMI CTAG 1 cut(s) 98
TaqI TCGA 1 cut(s) 171
TasI AATT 2 cut(s) 92, 183
TfiI GAWTC 2 cut(s) 26, 69
Tru1I TTAA 1 cut(s) 208
Tru9I TTAA 1 cut(s) 208
TspDTI ATGAA 3 cut(s) 102, 120, 177
XapI RAATTY 2 cut(s) 92, 183
XmiI GTMKAC 1 cut(s) 171
XspI CTAG 1 cut(s) 98
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.