Rh2AG457400

Regulatory subunit of the dimeric E1 enzyme. E1 activates RUB1 NEDD8 by first adenylating its C-terminal glycine residue with ATP, thereafter linking this residue to the side chain of the catalytic cysteine, yielding a RUB1-ECR1 thioester and free AMP. E1 finally transfers RUB1 to the catalytic cysteine of RCE1

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
Physical Location & Seq
Reverse (-)
67267710 .. 67269537
1828 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG457400.1

Sequence Viewer

Length: 375 bp
ATGTCCTTCATTTTCTCTATGGTTTTCTGGGTGCAGAAACATACTGTGATTGAGTCCAAGCCTGAACATTTTCTGGATGACCTTCGTTTGAATAATCCATGGCCTGAGCTTAGAAGGTACAGAGAGCTTATCAAAACTAGGATGACTGCAGATGATGTAGATAACTACAGTGAAGCATTGAGAACTCCTTTAAAGTCTTTACTCCTTGAGGAATTAGAATTCCTAGCAAATGAAGGTGGTGGTGAGGCACCCCTCGAGGGATCAATACCAGATATAACATCTTCAACTGAGCACTATGTAGCTTTACAGAAAACCTACCAAGCCAAGGCTGAGGCTGATTTTCTAGTATTGACCAAAGGGTTAGGACTCTTCTAA

Protein Analysis

124

Amino Acids

14.23

Weight (kDa)

4.91

Isoelectric Point (pI)

34.33

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AbsI CCTCGAGG 1 cut(s) 254
AccB1I GGYRCC 1 cut(s) 247
AclWI GGATC 1 cut(s) 268
AcsI RAATTY 1 cut(s) 218
AfaI GTAC 1 cut(s) 119
AfiI CCNNNNNNNGG 2 cut(s) 257, 325
AgsI TTSAA 2 cut(s) 91, 285
AluBI AGCT 3 cut(s) 109, 127, 302
AluI AGCT 3 cut(s) 109, 127, 302
Alw21I GWGCWC 1 cut(s) 294
AlwI GGATC 1 cut(s) 268
Ama87I CYCGRG 1 cut(s) 254
AoxI GGCC 1 cut(s) 101
ApoI RAATTY 1 cut(s) 218
Asp700I GAANNNNTTC 1 cut(s) 69
AsuHPI GGTGA 1 cut(s) 254
AvaI CYCGRG 1 cut(s) 254
BanI GGYRCC 1 cut(s) 247
Bbv12I GWGCWC 1 cut(s) 294
BbvCI CCTCAGC 1 cut(s) 330
BfaI CTAG 3 cut(s) 138, 224, 344
BfmI CTRYAG 2 cut(s) 147, 166
BmeT110I CYCGRG 1 cut(s) 254
BmiI GGNNCC 1 cut(s) 249
Bpu10I CCTNAGC 2 cut(s) 105, 330
BpuEI CTTGAG 1 cut(s) 227
BsaJI CCNNGG 2 cut(s) 98, 324
Bsc4I CCNNNNNNNGG 2 cut(s) 257, 325
BseDI CCNNGG 2 cut(s) 98, 324
BseGI GGATG 2 cut(s) 82, 147
BseLI CCNNNNNNNGG 2 cut(s) 257, 325
BseMII CTCAG 3 cut(s) 96, 279, 321
BsgI GTGCAG 1 cut(s) 53
BshFI GGCC 1 cut(s) 103
BshNI GGYRCC 1 cut(s) 247
BsiHKAI GWGCWC 1 cut(s) 294
BsiHKCI CYCGRG 1 cut(s) 254
BslI CCNNNNNNNGG 2 cut(s) 257, 325
BsnI GGCC 1 cut(s) 103
BsoBI CYCGRG 1 cut(s) 254
Bsp1286I GDGCHC 1 cut(s) 294
Bsp143I GATC 1 cut(s) 260
Bsp19I CCATGG 1 cut(s) 98
BspANI GGCC 1 cut(s) 103
BspCNI CTCAG 3 cut(s) 97, 280, 322
BspLI GGNNCC 1 cut(s) 249
BspMAI CTGCAG 1 cut(s) 151
BspPI GGATC 1 cut(s) 268
BspT107I GGYRCC 1 cut(s) 247
BssECI CCNNGG 2 cut(s) 98, 324
BssMI GATC 1 cut(s) 260
BssT1I CCWWGG 2 cut(s) 98, 324
Bst4CI ACNGT 2 cut(s) 46, 170
BstDEI CTNAG 4 cut(s) 105, 110, 288, 330
BstDSI CCRYGG 1 cut(s) 98
BstF5I GGATG 2 cut(s) 82, 147
BstKTI GATC 1 cut(s) 263
BstMBI GATC 1 cut(s) 260
BstSFI CTRYAG 2 cut(s) 147, 166
BsuRI GGCC 1 cut(s) 103
BtgI CCRYGG 1 cut(s) 98
BtsCI GGATG 2 cut(s) 82, 147
BtsIMutI CAGTG 1 cut(s) 175
Csp6I GTAC 1 cut(s) 118
CviAII CATG 1 cut(s) 99
CviJI RGCY 8 cut(s) 61, 103, 109, 127, 302, 323, 329, 335
CviKI_1 RGCY 8 cut(s) 61, 103, 109, 127, 302, 323, 329, 335
CviQI GTAC 1 cut(s) 118
DdeI CTNAG 4 cut(s) 105, 110, 288, 330
DpnI GATC 1 cut(s) 262
DpnII GATC 1 cut(s) 260
DraI TTTAAA 1 cut(s) 192
Eco130I CCWWGG 2 cut(s) 98, 324
Eco88I CYCGRG 1 cut(s) 254
EcoRI GAATTC 1 cut(s) 218
EcoT14I CCWWGG 2 cut(s) 98, 324
ErhI CCWWGG 2 cut(s) 98, 324
FaeI CATG 1 cut(s) 102
FaiI YATR 5 cut(s) 20, 42, 100, 275, 297
FatI CATG 1 cut(s) 98
FokI GGATG 2 cut(s) 89, 154
FspBI CTAG 3 cut(s) 138, 224, 344
HaeIII GGCC 1 cut(s) 103
Hin1II CATG 1 cut(s) 102
HinfI GANTC 2 cut(s) 53, 366
HphI GGTGA 1 cut(s) 254
Hpy188III TCNNGA 1 cut(s) 74
HpyAV CCTTC 4 cut(s) 16, 92, 108, 227
HpyCH4III ACNGT 2 cut(s) 46, 170
HpyCH4V TGCA 2 cut(s) 34, 149
HpyF3I CTNAG 4 cut(s) 105, 110, 288, 330
Hsp92II CATG 1 cut(s) 102
Kzo9I GATC 1 cut(s) 260
LpnPI CCDG 5 cut(s) 13, 59, 75, 117, 282
MaeI CTAG 3 cut(s) 138, 224, 344
MalI GATC 1 cut(s) 262
MboI GATC 1 cut(s) 260
MboII GAAGA 2 cut(s) 273, 361
MhlI GDGCHC 1 cut(s) 294
MluCI AATT 2 cut(s) 212, 218
MlyI GAGTC 2 cut(s) 62, 360
MnlI CCTC 5 cut(s) 202, 238, 250, 263, 325
MroXI GAANNNNTTC 1 cut(s) 69
MseI TTAA 1 cut(s) 191
NcoI CCATGG 1 cut(s) 98
NdeII GATC 1 cut(s) 260
NlaIII CATG 1 cut(s) 102
NlaIV GGNNCC 1 cut(s) 249
PaeR7I CTCGAG 1 cut(s) 254
PdmI GAANNNNTTC 1 cut(s) 69
PleI GAGTC 2 cut(s) 61, 360
PpsI GAGTC 2 cut(s) 61, 360
PspN4I GGNNCC 1 cut(s) 249
PspXI VCTCGAGB 1 cut(s) 254
PstI CTGCAG 1 cut(s) 151
RsaI GTAC 1 cut(s) 119
RsaNI GTAC 1 cut(s) 118
SaqAI TTAA 1 cut(s) 191
Sau3AI GATC 1 cut(s) 260
SchI GAGTC 2 cut(s) 62, 360
SduI GDGCHC 1 cut(s) 294
SetI ASST 7 cut(s) 84, 111, 119, 129, 238, 304, 317
SfcI CTRYAG 2 cut(s) 147, 166
Sfr274I CTCGAG 1 cut(s) 254
SlaI CTCGAG 1 cut(s) 254
SmlI CTYRAG 2 cut(s) 206, 254
SmoI CTYRAG 2 cut(s) 206, 254
Sse9I AATT 2 cut(s) 212, 218
SspMI CTAG 3 cut(s) 138, 224, 344
StyI CCWWGG 2 cut(s) 98, 324
TaaI ACNGT 2 cut(s) 46, 170
TaqI TCGA 1 cut(s) 255
TasI AATT 2 cut(s) 212, 218
Tru1I TTAA 1 cut(s) 191
Tru9I TTAA 1 cut(s) 191
TscAI CASTG 1 cut(s) 175
TspDTI ATGAA 1 cut(s) 246
TspRI CASTG 1 cut(s) 175
XapI RAATTY 1 cut(s) 218
XhoI CTCGAG 1 cut(s) 254
XmnI GAANNNNTTC 1 cut(s) 69
XspI CTAG 3 cut(s) 138, 224, 344
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.