Rh1CG284200

Regulatory subunit of the dimeric E1 enzyme. E1 activates RUB1 NEDD8 by first adenylating its C-terminal glycine residue with ATP, thereafter linking this residue to the side chain of the catalytic cysteine, yielding a RUB1-ECR1 thioester and free AMP. E1 finally transfers RUB1 to the catalytic cysteine of RCE1

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1C
Physical Location & Seq
Forward (+)
55507682 .. 55519738
12057 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1CG284200.1

Sequence Viewer

Length: 276 bp
ATGGCCGTTGCTGTCAAGACATTTTACTCAGAAAGTATCGAAAGCATTAAACAGTGGCAGGAATTCCTAGCAAATGAAGGTGGTGGTGAGGCACCCCTCGAGGGATCAGTACCAGATATAACATCTTCAACTGAGTTAGTCGACATCCCCAGAATTTCATGGATCAATGCGTCTGAGGTTCTTTCTCAAAGAATCCATCTTCAAGCAGAGACTGTTGCAAGTGAAGAAAGATTAATGGATGTAAATGTTGGAGAGCACAAGGCCAGGACTCGATAA

Protein Analysis

91

Amino Acids

10.09

Weight (kDa)

4.68

Isoelectric Point (pI)

52.43

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AbsI CCTCGAGG 1 cut(s) 98
AccB1I GGYRCC 1 cut(s) 91
AccI GTMKAC 1 cut(s) 141
AclWI GGATC 2 cut(s) 112, 170
AcoI YGGCCR 1 cut(s) 3
AcsI RAATTY 2 cut(s) 62, 153
AfaI GTAC 1 cut(s) 111
AfiI CCNNNNNNNGG 1 cut(s) 101
AgsI TTSAA 2 cut(s) 129, 203
AjnI CCWGG 1 cut(s) 263
Alw21I GWGCWC 1 cut(s) 258
Alw26I GTCTC 1 cut(s) 203
AlwI GGATC 2 cut(s) 112, 170
AlwNI CAGNNNCTG 1 cut(s) 212
Ama87I CYCGRG 1 cut(s) 98
AoxI GGCC 2 cut(s) 3, 261
ApoI RAATTY 2 cut(s) 62, 153
AseI ATTAAT 1 cut(s) 233
AsuHPI GGTGA 1 cut(s) 98
AvaI CYCGRG 1 cut(s) 98
BanI GGYRCC 1 cut(s) 91
Bbv12I GWGCWC 1 cut(s) 258
BccI CCATC 1 cut(s) 204
BciT130I CCWGG 1 cut(s) 265
BcoDI GTCTC 1 cut(s) 203
BfaI CTAG 1 cut(s) 68
Bme1390I CCNGG 1 cut(s) 265
BmeT110I CYCGRG 1 cut(s) 98
BmiI GGNNCC 1 cut(s) 93
BmrFI CCNGG 1 cut(s) 265
Bsc4I CCNNNNNNNGG 1 cut(s) 101
BseBI CCWGG 1 cut(s) 265
BseGI GGATG 2 cut(s) 144, 244
BseLI CCNNNNNNNGG 1 cut(s) 101
BseMII CTCAG 3 cut(s) 42, 123, 165
BshFI GGCC 2 cut(s) 5, 263
BshNI GGYRCC 1 cut(s) 91
BsiHKAI GWGCWC 1 cut(s) 258
BsiHKCI CYCGRG 1 cut(s) 98
BslI CCNNNNNNNGG 1 cut(s) 101
BsmAI GTCTC 1 cut(s) 203
BsnI GGCC 2 cut(s) 5, 263
BsoBI CYCGRG 1 cut(s) 98
Bsp1286I GDGCHC 1 cut(s) 258
Bsp143I GATC 2 cut(s) 104, 162
BspANI GGCC 2 cut(s) 5, 263
BspCNI CTCAG 3 cut(s) 41, 124, 166
BspLI GGNNCC 1 cut(s) 93
BspPI GGATC 2 cut(s) 112, 170
BspT107I GGYRCC 1 cut(s) 91
BssMI GATC 2 cut(s) 104, 162
Bst2UI CCWGG 1 cut(s) 265
Bst4CI ACNGT 2 cut(s) 54, 214
BstDEI CTNAG 3 cut(s) 28, 132, 174
BstF5I GGATG 2 cut(s) 144, 244
BstKTI GATC 2 cut(s) 107, 165
BstMAI GTCTC 1 cut(s) 203
BstMBI GATC 2 cut(s) 104, 162
BstNI CCWGG 1 cut(s) 265
BstSCI CCNGG 1 cut(s) 263
BsuRI GGCC 2 cut(s) 5, 263
BtsCI GGATG 2 cut(s) 144, 244
BtsIMutI CAGTG 1 cut(s) 59
CaiI CAGNNNCTG 1 cut(s) 212
CseI GACGC 1 cut(s) 159
Csp6I GTAC 1 cut(s) 110
CviAII CATG 1 cut(s) 159
CviJI RGCY 2 cut(s) 5, 263
CviKI_1 RGCY 2 cut(s) 5, 263
CviQI GTAC 1 cut(s) 110
DdeI CTNAG 3 cut(s) 28, 132, 174
DpnI GATC 2 cut(s) 106, 164
DpnII GATC 2 cut(s) 104, 162
EaeI YGGCCR 1 cut(s) 3
Eco88I CYCGRG 1 cut(s) 98
EcoRI GAATTC 1 cut(s) 62
EcoRII CCWGG 1 cut(s) 263
FaeI CATG 1 cut(s) 162
FaiI YATR 2 cut(s) 119, 160
FatI CATG 1 cut(s) 158
FblI GTMKAC 1 cut(s) 141
FokI GGATG 2 cut(s) 131, 251
FspBI CTAG 1 cut(s) 68
HaeIII GGCC 2 cut(s) 5, 263
HgaI GACGC 1 cut(s) 159
Hin1II CATG 1 cut(s) 162
HincII GTYRAC 1 cut(s) 142
HindII GTYRAC 1 cut(s) 142
HinfI GANTC 2 cut(s) 192, 268
HphI GGTGA 1 cut(s) 98
Hpy166II GTNNAC 1 cut(s) 142
Hpy188I TCNGA 2 cut(s) 31, 175
Hpy188III TCNNGA 1 cut(s) 16
Hpy8I GTNNAC 1 cut(s) 142
HpyAV CCTTC 1 cut(s) 71
HpyCH4III ACNGT 2 cut(s) 54, 214
HpyCH4V TGCA 1 cut(s) 218
HpyF3I CTNAG 3 cut(s) 28, 132, 174
Hsp92II CATG 1 cut(s) 162
Kzo9I GATC 2 cut(s) 104, 162
LpnPI CCDG 4 cut(s) 44, 126, 163, 250
MaeI CTAG 1 cut(s) 68
MalI GATC 2 cut(s) 106, 164
MboI GATC 2 cut(s) 104, 162
MboII GAAGA 3 cut(s) 117, 191, 236
MhlI GDGCHC 1 cut(s) 258
MluCI AATT 2 cut(s) 62, 153
MlyI GAGTC 1 cut(s) 262
MmeI TCCRAC 1 cut(s) 229
MnlI CCTC 4 cut(s) 82, 94, 107, 169
MseI TTAA 2 cut(s) 48, 233
MspR9I CCNGG 1 cut(s) 265
MvaI CCWGG 1 cut(s) 265
NdeII GATC 2 cut(s) 104, 162
NlaIII CATG 1 cut(s) 162
NlaIV GGNNCC 1 cut(s) 93
PaeR7I CTCGAG 1 cut(s) 98
PfeI GAWTC 1 cut(s) 192
PleI GAGTC 1 cut(s) 262
PpsI GAGTC 1 cut(s) 262
PshBI ATTAAT 1 cut(s) 233
Psp6I CCWGG 1 cut(s) 263
PspGI CCWGG 1 cut(s) 263
PspN4I GGNNCC 1 cut(s) 93
PspXI VCTCGAGB 1 cut(s) 98
PstNI CAGNNNCTG 1 cut(s) 212
RsaI GTAC 1 cut(s) 111
RsaNI GTAC 1 cut(s) 110
SalI GTCGAC 1 cut(s) 140
SaqAI TTAA 2 cut(s) 48, 233
Sau3AI GATC 2 cut(s) 104, 162
SchI GAGTC 1 cut(s) 262
ScrFI CCNGG 1 cut(s) 265
SduI GDGCHC 1 cut(s) 258
SetI ASST 2 cut(s) 82, 180
Sfr274I CTCGAG 1 cut(s) 98
SlaI CTCGAG 1 cut(s) 98
SmlI CTYRAG 1 cut(s) 98
SmoI CTYRAG 1 cut(s) 98
Sse9I AATT 2 cut(s) 62, 153
SspMI CTAG 1 cut(s) 68
StyD4I CCNGG 1 cut(s) 263
TaaI ACNGT 2 cut(s) 54, 214
TaqI TCGA 4 cut(s) 39, 99, 141, 271
TasI AATT 2 cut(s) 62, 153
TfiI GAWTC 1 cut(s) 192
Tru1I TTAA 2 cut(s) 48, 233
Tru9I TTAA 2 cut(s) 48, 233
TscAI CASTG 1 cut(s) 59
TspDTI ATGAA 2 cut(s) 90, 147
TspRI CASTG 1 cut(s) 59
VspI ATTAAT 1 cut(s) 233
XapI RAATTY 2 cut(s) 62, 153
XhoI CTCGAG 1 cut(s) 98
XmiI GTMKAC 1 cut(s) 141
XspI CTAG 1 cut(s) 68
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.